<?xml version='1.0'?>
<!DOCTYPE art SYSTEM 'http://www.biomedcentral.com/xml/article.dtd'>
<art>
   <ui>gb-2008-9-9-r143</ui>
   <ji>GBJ</ji>
   <fm>
      <dochead>Research</dochead>
      <bibl>
         <title>
            <p>The signature of long-standing balancing selection at the human defensin &#946;-1 promoter</p>
         </title>
         <aug>
            <au id="A1">
               <snm>Cagliani</snm>
               <fnm>Rachele</fnm>
               <insr iid="I1"/>
               <email>rachele.cagliani@bp.lnf.it</email>
            </au>
            <au id="A2">
               <snm>Fumagalli</snm>
               <fnm>Matteo</fnm>
               <insr iid="I1"/>
               <insr iid="I2"/>
               <email>matteo.fumagalli@bp.lnf.it</email>
            </au>
            <au id="A3">
               <snm>Riva</snm>
               <fnm>Stefania</fnm>
               <insr iid="I1"/>
               <email>stefania.riva@bp.lnf.it</email>
            </au>
            <au id="A4">
               <snm>Pozzoli</snm>
               <fnm>Uberto</fnm>
               <insr iid="I1"/>
               <email>uberto.pozzoli@bp.lnf.it</email>
            </au>
            <au id="A5">
               <snm>Comi</snm>
               <mi>P</mi>
               <fnm>Giacomo</fnm>
               <insr iid="I3"/>
               <email>giacomo.comi@unimi.it</email>
            </au>
            <au id="A6">
               <snm>Menozzi</snm>
               <fnm>Giorgia</fnm>
               <insr iid="I1"/>
               <email>giorgia.menozzi@bp.lnf.it</email>
            </au>
            <au id="A7">
               <snm>Bresolin</snm>
               <fnm>Nereo</fnm>
               <insr iid="I1"/>
               <insr iid="I3"/>
               <email>nereo.bresolin@bp.lnf.it</email>
            </au>
            <au id="A8" ca="yes">
               <snm>Sironi</snm>
               <fnm>Manuela</fnm>
               <insr iid="I1"/>
               <email>manuela.sironi@BP.LNF.it</email>
            </au>
         </aug>
         <insg>
            <ins id="I1">
               <p>Scientific Institute IRCCS E. Medea, Bioinformatic Lab, Via don L. Monza 20, 23842 Bosisio Parini (LC), Italy</p>
            </ins>
            <ins id="I2">
               <p>Bioengineering Department, Politecnico di Milano, Pzza L. da Vinci, 32, 20133 Milan, Italy</p>
            </ins>
            <ins id="I3">
               <p>Dino Ferrari Centre, Department of Neurological Sciences, University of Milan, IRCCS Ospedale Maggiore Policlinico, Mangiagalli and Regina Elena Foundation, Via F. Sforza 35, 20100 Milan, Italy</p>
            </ins>
         </insg>
         <source>Genome Biology</source>
         <issn>1465-6906</issn>
         <pubdate>2008</pubdate>
         <volume>9</volume>
         <issue>9</issue>
         <fpage>R143</fpage>
         <url>http://genomebiology.com/2008/9/9/R143</url>
         <xrefbib>
            <pubidlist>
               <pubid idtype="pmpid">18817538</pubid>
               <pubid idtype="doi">10.1186/gb-2008-9-9-r143</pubid>
            </pubidlist>
         </xrefbib>
      </bibl>
      <history>
         <rec>
            <date>
               <day>28</day>
               <month>3</month>
               <year>2008</year>
            </date>
         </rec>
         <revrec>
            <date>
               <day>21</day>
               <month>5</month>
               <year>2008</year>
            </date>
         </revrec>
         <acc>
            <date>
               <day>25</day>
               <month>9</month>
               <year>2008</year>
            </date>
         </acc>
         <pub>
            <date>
               <day>25</day>
               <month>09</month>
               <year>2008</year>
            </date>
         </pub>
      </history>
      <cpyrt>
         <year>2008</year>
         <collab>Cagliani et al.; licensee BioMed Central Ltd.</collab>
         <note>This is an open access article distributed under the terms of the Creative Commons Attribution License (<url>http://creativecommons.org/licenses/by/2.0</url>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</note>
      </cpyrt>
      <shorttitle>
         <p>Balancing selection</p>
      </shorttitle>
      <shortabs>
         <p>Analysis of the human beta defensin 1 promoter region in six human populations reveals a signature of balancing selection.</p>
      </shortabs>
      <abs>
         <sec>
            <st>
               <p>Abstract</p>
            </st>
            <sec>
               <st>
                  <p>Background</p>
               </st>
               <p>Defensins, small endogenous peptides with antimicrobial activity, are pivotal components of the innate immune response. A large cluster of defensin genes is located on human chromosome 8p; among them the beta defensin 1 (<it>DEFB1</it>) promoterhas been extensively studied since discovery that specific polymorphisms and haplotypes associate with asthma and atopy, susceptibility to severe sepsis, as well as HIV and <it>Candida </it>infection predisposition.</p>
            </sec>
            <sec>
               <st>
                  <p>Results</p>
               </st>
               <p>Here, we characterize the sequence variation and haplotype structure of the <it>DEFB1 </it>promoter region in six human populations. In all of them, we observed high levels of nucleotide variation, an excess of intermediate-frequency alleles, reduced population differentiation and a genealogy with common haplotypes separated by deep branches. Indeed, a significant departure from the expectation of evolutionary neutrality was observed in all populations and the possibility that this is due to demographic history alone was ruled out. Also, we verified that the selection signature is restricted to the promoter region and not due to a linked balanced polymorphism. A phylogeny-based estimation indicated that the two major haplotype clades separated around 4.5 million years ago, approximately the time when the human and chimpanzee lineages split.</p>
            </sec>
            <sec>
               <st>
                  <p>Conclusion</p>
               </st>
               <p>Altogether, these features represent strong molecular signatures of long-term balancing selection, a process that is thought to be extremely rare outside major histocompatibility complex genes. Our data indicate that the <it>DEFB1 </it>promoter region carries functional variants and support previous hypotheses whereby alleles predisposing to atopic disorders are widespread in modern societies because they conferred resistance to pathogens in ancient settings.</p>
            </sec>
         </sec>
      </abs>
   </fm>
   <meta>
      <classifications>
         <classification type="BMC" subtype="man_spc_id" id="30010008">Evolution</classification>
         <classification type="BMC" subtype="man_spc_id" id="30010011">Immunology</classification>
         <classification type="BMC" subtype="man_spc_id" id="30010016">Molecular biology</classification>
      </classifications>
   </meta>
   <bdy>
      <sec>
         <st>
            <p>Background</p>
         </st>
         <p>Defensins comprise a large family of small endogenous peptides with antimicrobial activity against a wide range of microorganisms <abbrgrp><abbr bid="B1">1</abbr><abbr bid="B2">2</abbr></abbrgrp>. Although initially regarded as pivotal components of the innate immune system, recent evidence has indicated that defensins also play roles in the recruitment of adaptive immune cells <abbrgrp><abbr bid="B3">3</abbr></abbrgrp> and in promoting antigen-specific immune responses <abbrgrp><abbr bid="B4">4</abbr></abbrgrp>.</p>
         <p>In humans two defensin subfamilies have been described (&#945; and &#946;), the structural difference residing in the linear spacing and pairing of their six conserved cysteine residues. While &#945;-defensins are expressed by neutrophils and intestinal Paneth cells, &#946;-defensins are mainly produced by epithelia <abbrgrp><abbr bid="B5">5</abbr></abbrgrp>.</p>
         <p>In mammals, defensins represent large multigene families and a major defensin cluster localizes to human chromosome 8p22-23, where several &#945;- and &#946;-defensin genes are located. Recent evidence <abbrgrp><abbr bid="B6">6</abbr></abbrgrp> has indicated that &#946;-defensin genes on chromosome 8p originated by successive rounds of duplication followed by a complex evolutionary history involving both negative and positive selection with variable pressures among mammalian lineages <abbrgrp><abbr bid="B7">7</abbr></abbrgrp>. Given the relevance of defensins in antimicrobial response and the conundrum whereby increased protein sequence diversity in the immune system enhances the spectrum of pathogen recognition, defensin coding exons have attracted much more interest in evolutionary studies compared to noncoding sequences. Yet, growing evidence suggests that 5' <it>cis </it>regulatory regions of genes such as <it>CCR5 </it><abbrgrp><abbr bid="B8">8</abbr></abbrgrp>, <it>HLA-G </it><abbrgrp><abbr bid="B9">9</abbr></abbrgrp>, <it>HLA-DQA1 </it><abbrgrp><abbr bid="B10">10</abbr></abbrgrp> and <it>HLA-DPA1/DPB1 </it><abbrgrp><abbr bid="B11">11</abbr></abbrgrp> have been subjected to balancing selection during recent primate history.</p>
         <p>Among defensins, the human &#946;-defensin 1 (<it>DEFB1 </it>[OMIM *602056]) promoter has been extensively studied since specific polymorphisms and haplotypes of it have been associated with asthma and atopy <abbrgrp><abbr bid="B12">12</abbr></abbrgrp>, susceptibility to severe sepsis <abbrgrp><abbr bid="B13">13</abbr></abbrgrp>, as well as HIV <abbrgrp><abbr bid="B14">14</abbr><abbr bid="B15">15</abbr></abbrgrp> and <it>Candida </it><abbrgrp><abbr bid="B16">16</abbr></abbrgrp> infection predisposition. Moreover, recent evidence <abbrgrp><abbr bid="B17">17</abbr></abbrgrp> has indicated that reduced expression of <it>DEFB1 </it>is found in a high percentage of renal and prostate cancers, therefore suggesting that <it>DEFB1 </it>acts as a tumor suppressor gene. These findings, together with the demonstrated functional significance of polymorphisms within <it>DEFB1 </it>5' regulatory sequence, indicate that this region might represent a target of natural selection.</p>
      </sec>
      <sec>
         <st>
            <p>Results</p>
         </st>
         <sec>
            <st>
               <p>Nucleotide diversity at the <it>DEFB1 </it>promoter region</p>
            </st>
            <p>We sequenced the 1,400 bp region immediately upstream of the <it>DEFB1 </it>translation start site (Figure <figr fid="F1">1</figr>) in 83 individuals with different ethnic origins (Yoruba from Nigeria <abbrgrp><abbr bid="B18">18</abbr></abbrgrp> (YRI), Asians (AS), South American Indians (SAI), Australian Aborigines (AUA)); additional data derived from full gene resequencing of 47 subjects (24 African Americans (AA) and 23 European Americans (EA)) were retrieved from the Innate Immunity PGA (IIPGA) web site <abbrgrp><abbr bid="B19">19</abbr></abbrgrp>. A total of 27 single nucleotide polymorphism (SNPs) were identified and haplotypes (Additional data file 1) were inferred using PHASE <abbrgrp><abbr bid="B20">20</abbr><abbr bid="B21">21</abbr></abbrgrp>. The analyzed region encompasses all polymorphic variants previously shown to modulate <it>DEFB1 </it>expression levels. As a control for the AA and EA populations, data for 20 promoter regions were retrieved for 20 genes in the IIPGA. In particular, the 2 kb upstream of the translation initiation site of other innate immunity genes genotyped for AA and EA were retrieved only if the initial ATG was located in the first exon (as it is for <it>DEFB1</it>) and if it could be unequivocally identified. Also, promoter regions were discarded if located in recombination hotspots or in resequencing gaps. A total of 20 promoter regions finally constituted the control dataset. Data concerning the number of segregating sites and nucleotide diversity at the <it>DEFB1 </it>promoter region are summarized in Table <tblr tid="T1">1</tblr> and indicate that both &#952;<sub>W </sub><abbrgrp><abbr bid="B22">22</abbr></abbrgrp> and &#960; <abbrgrp><abbr bid="B23">23</abbr></abbrgrp> are definitely higher for <it>DEFB1 </it>compared to maximum values calculated for IIPGA gene promoters.</p>
            <tbl id="T1">
               <title>
                  <p>Table 1</p>
               </title>
               <caption>
                  <p>Summary statistics of the <it>DEFB1 </it>promoter region</p>
               </caption>
               <tblbdy cols="8">
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c cspan="6" ca="center">
                        <p>Population</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c cspan="6">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>AA</p>
                     </c>
                     <c ca="center">
                        <p>EA</p>
                     </c>
                     <c ca="center">
                        <p>YRI</p>
                     </c>
                     <c ca="center">
                        <p>AS</p>
                     </c>
                     <c ca="center">
                        <p>SAI</p>
                     </c>
                     <c ca="center">
                        <p>AUA</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="8">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>N<sup>a</sup></p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>48</p>
                     </c>
                     <c ca="center">
                        <p>46</p>
                     </c>
                     <c ca="center">
                        <p>44</p>
                     </c>
                     <c ca="center">
                        <p>50</p>
                     </c>
                     <c ca="center">
                        <p>48</p>
                     </c>
                     <c ca="center">
                        <p>24</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>S<sup>b</sup></p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>22</p>
                     </c>
                     <c ca="center">
                        <p>16</p>
                     </c>
                     <c ca="center">
                        <p>23</p>
                     </c>
                     <c ca="center">
                        <p>17</p>
                     </c>
                     <c ca="center">
                        <p>16</p>
                     </c>
                     <c ca="center">
                        <p>17</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>&#952;<sub>W </sub>(&#215; 10<sup>-4</sup>)</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>DEFB1</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>35.41</p>
                     </c>
                     <c ca="center">
                        <p>26.00</p>
                     </c>
                     <c ca="center">
                        <p>37.71</p>
                     </c>
                     <c ca="center">
                        <p>27.11</p>
                     </c>
                     <c ca="center">
                        <p>25.75</p>
                     </c>
                     <c ca="center">
                        <p>32.52</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>IIPGA<sup>c</sup></p>
                     </c>
                     <c ca="center">
                        <p>15.77</p>
                     </c>
                     <c ca="center">
                        <p>14.79</p>
                     </c>
                     <c ca="center">
                        <p>NA</p>
                     </c>
                     <c ca="center">
                        <p>NA</p>
                     </c>
                     <c ca="center">
                        <p>NA</p>
                     </c>
                     <c ca="center">
                        <p>NA</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>&#960; (&#215; 10<sup>-4</sup>)</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>DEFB1</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>53.73</p>
                     </c>
                     <c ca="center">
                        <p>53.28</p>
                     </c>
                     <c ca="center">
                        <p>45.85</p>
                     </c>
                     <c ca="center">
                        <p>54.96</p>
                     </c>
                     <c ca="center">
                        <p>23.037</p>
                     </c>
                     <c ca="center">
                        <p>51.84</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>IIPGA<sup>c</sup></p>
                     </c>
                     <c ca="center">
                        <p>19.20</p>
                     </c>
                     <c ca="center">
                        <p>17.04</p>
                     </c>
                     <c ca="center">
                        <p>NA</p>
                     </c>
                     <c ca="center">
                        <p>NA</p>
                     </c>
                     <c ca="center">
                        <p>NA</p>
                     </c>
                     <c ca="center">
                        <p>NA</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Tajima's D</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>DEFB1</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>1.68<sup>f</sup></p>
                     </c>
                     <c ca="center">
                        <p>3.29<sup>e</sup></p>
                     </c>
                     <c ca="center">
                        <p>0.71</p>
                     </c>
                     <c ca="center">
                        <p>3.21<sup>e</sup></p>
                     </c>
                     <c ca="center">
                        <p>-0.33</p>
                     </c>
                     <c ca="center">
                        <p>2.13<sup>f</sup></p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>IIPGA<sup>c</sup></p>
                     </c>
                     <c ca="center">
                        <p>1.25</p>
                     </c>
                     <c ca="center">
                        <p>1.24</p>
                     </c>
                     <c ca="center">
                        <p>NA</p>
                     </c>
                     <c ca="center">
                        <p>NA</p>
                     </c>
                     <c ca="center">
                        <p>NA</p>
                     </c>
                     <c ca="center">
                        <p>NA</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>NIEHS (5 kb)<sup>d</sup></p>
                     </c>
                     <c ca="center">
                        <p>0.99</p>
                     </c>
                     <c ca="center">
                        <p>0.99</p>
                     </c>
                     <c ca="center">
                        <p>0.93</p>
                     </c>
                     <c ca="center">
                        <p>>0.99</p>
                     </c>
                     <c ca="center">
                        <p>NA</p>
                     </c>
                     <c ca="center">
                        <p>NA</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>
                           <it>p</it>
                           <sup>g</sup>
                        </p>
                     </c>
                     <c ca="center">
                        <p>0.011</p>
                     </c>
                     <c ca="center">
                        <p>0.0001</p>
                     </c>
                     <c ca="center">
                        <p>0.092</p>
                     </c>
                     <c ca="center">
                        <p>0.0003</p>
                     </c>
                     <c ca="center">
                        <p>NA</p>
                     </c>
                     <c ca="center">
                        <p>NA</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Fu and Li's D*</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>DEFB1</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>1.38<sup>f</sup></p>
                     </c>
                     <c ca="center">
                        <p>1.59<sup>f</sup></p>
                     </c>
                     <c ca="center">
                        <p>1.085</p>
                     </c>
                     <c ca="center">
                        <p>1.62<sup>e</sup></p>
                     </c>
                     <c ca="center">
                        <p>1.60<sup>f</sup></p>
                     </c>
                     <c ca="center">
                        <p>1.23</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>IIPGA<sup>c</sup></p>
                     </c>
                     <c ca="center">
                        <p>1.35</p>
                     </c>
                     <c ca="center">
                        <p>1.36</p>
                     </c>
                     <c ca="center">
                        <p>NA</p>
                     </c>
                     <c ca="center">
                        <p>NA</p>
                     </c>
                     <c ca="center">
                        <p>NA</p>
                     </c>
                     <c ca="center">
                        <p>NA</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>NIEHS (5 kb)<sup>d</sup></p>
                     </c>
                     <c ca="center">
                        <p>>0.99</p>
                     </c>
                     <c ca="center">
                        <p>0.98</p>
                     </c>
                     <c ca="center">
                        <p>0.97</p>
                     </c>
                     <c ca="center">
                        <p>>0.99</p>
                     </c>
                     <c ca="center">
                        <p>NA</p>
                     </c>
                     <c ca="center">
                        <p>NA</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>
                           <it>p</it>
                           <sup>g</sup>
                        </p>
                     </c>
                     <c ca="center">
                        <p>0.0058</p>
                     </c>
                     <c ca="center">
                        <p>0.0001</p>
                     </c>
                     <c ca="center">
                        <p>0.069</p>
                     </c>
                     <c ca="center">
                        <p>&lt;0.0001</p>
                     </c>
                     <c ca="center">
                        <p>NA</p>
                     </c>
                     <c ca="center">
                        <p>NA</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Fu and Li's F*</p>
                     </c>
                     <c ca="left">
                        <p>
                           <it>DEFB1</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>1.76<sup>f</sup></p>
                     </c>
                     <c ca="center">
                        <p>2.56<sup>e</sup></p>
                     </c>
                     <c ca="center">
                        <p>1.13</p>
                     </c>
                     <c ca="center">
                        <p>2.56<sup>e</sup></p>
                     </c>
                     <c ca="center">
                        <p>1.12</p>
                     </c>
                     <c ca="center">
                        <p>1.76<sup>f</sup></p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>IIPGA<sup>c</sup></p>
                     </c>
                     <c ca="center">
                        <p>1.46</p>
                     </c>
                     <c ca="center">
                        <p>1.14</p>
                     </c>
                     <c ca="center">
                        <p>NA</p>
                     </c>
                     <c ca="center">
                        <p>NA</p>
                     </c>
                     <c ca="center">
                        <p>NA</p>
                     </c>
                     <c ca="center">
                        <p>NA</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>NIEHS (5 kb)<sup>d</sup></p>
                     </c>
                     <c ca="center">
                        <p>>0.99</p>
                     </c>
                     <c ca="center">
                        <p>0.99</p>
                     </c>
                     <c ca="center">
                        <p>0.96</p>
                     </c>
                     <c ca="center">
                        <p>>0.99</p>
                     </c>
                     <c ca="center">
                        <p>NA</p>
                     </c>
                     <c ca="center">
                        <p>NA</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>
                           <it>p</it>
                           <sup>g</sup>
                        </p>
                     </c>
                     <c ca="center">
                        <p>0.0031</p>
                     </c>
                     <c ca="center">
                        <p>&lt;0.0001</p>
                     </c>
                     <c ca="center">
                        <p>0.045</p>
                     </c>
                     <c ca="center">
                        <p>&lt;0.0001</p>
                     </c>
                     <c ca="center">
                        <p>NA</p>
                     </c>
                     <c ca="center">
                        <p>NA</p>
                     </c>
                  </r>
               </tblbdy>
               <tblfn>
                  <p><sup>a</sup>Sample size. <sup>b</sup>Number of segregating sites. <sup>c</sup>Maximum values for 20 IIPGA gene promoters. <sup>d</sup>Percentile rank relative to the distribution of 5 kb regions deriving from NIEHS genes. <sup>e</sup><it>p</it>-value (standard neutral model) &lt;0.01. <sup>f</sup><it>p</it>-value (standard neutral model) &lt;0.05. <sup>g</sup><it>p</it>-values obtained by applying a calibrated population genetics model, as described in the text. NA, not available.</p>
               </tblfn>
            </tbl>
            <fig id="F1">
               <title>
                  <p>Figure 1</p>
               </title>
               <caption>
                  <p>Sliding window analysis along the <it>DEFB1 </it>gene sequence</p>
               </caption>
               <text>
                  <p>Sliding window analysis along the <it>DEFB1 </it>gene sequence. <b>(a-c) </b>Analysis of &#960; (solid line) and &#952;<sub>W </sub>(hatched line) is shown for AA (a, red) and EA (b, blue) together with human-macaque divergence (c). <b>(d) </b>Tajima's D for AA (red) and EA (blue). <b>(e) </b>Population differentiation between AA and EA as quantified by F<sub>ST</sub>. In all cases, windows of 500 bp with a step of 2 bp were used. The <it>DEFB1 </it>gene structure is also shown and the shaded box denotes the region we analyzed.</p>
               </text>
               <graphic file="gb-2008-9-9-r143-1"/>
            </fig>
            <p>We excluded that the high degree of polymorphisms at the <it>DEFB1 </it>promoter is due to non-allelic gene conversion with other paralogous defensin genes on chromosome 8 by applying Sawyer's gene conversion algorithm <abbrgrp><abbr bid="B24">24</abbr></abbrgrp>.</p>
         </sec>
         <sec>
            <st>
               <p>Neutrality tests</p>
            </st>
            <p>Under neutral evolution, the amount of within-species diversity is predicted to correlate with levels of between-species divergence, since both depend on the neutral mutation rate <abbrgrp><abbr bid="B25">25</abbr></abbrgrp>. The HKA test <abbrgrp><abbr bid="B26">26</abbr></abbrgrp> is commonly used to verify whether this expectation is verified. We performed both pairwise and maximum-likelihood (MLHKA) <abbrgrp><abbr bid="B27">27</abbr></abbrgrp> tests with <it>Rhesus macaque </it>as an outgroup (instead of chimpanzee) so that greater divergence time results in more fixed differences and improves power to detect selection. For pairwise HKA tests we compared polymorphism and divergence level at the promoter region of <it>DEFB1 </it>with the 20 IIPGA genes; we consider these comparisons to be well-suited since lower sequence conservation and faster evolutionary rates are though to be a widespread feature of immune response genes <abbrgrp><abbr bid="B28">28</abbr><abbr bid="B29">29</abbr></abbrgrp>. Since IIPGA data refer to AA and EA, only these populations were used in the comparison; pairwise HKA tests (Table <tblr tid="T2">2</tblr>) yielded significant results (<it>p </it>&lt; 0.05) in 11 out of 20 cases (with 5 additional tests yielding a <it>p </it>&lt; 0.10), suggesting increased diversity at the <it>DEFB1 </it>promoter compared to most loci. For further confirmation, we performed a MLHKA test by comparing the <it>DEFB1 </it>5' region to all 20 promoter regions: a significant result was obtained (k = 3.31, <it>p </it>= 0.0018).</p>
            <tbl id="T2">
               <title>
                  <p>Table 2</p>
               </title>
               <caption>
                  <p>Pairwise HKA tests</p>
               </caption>
               <tblbdy cols="7">
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c cspan="3" ca="center">
                        <p>Intraspecific polymorphisms</p>
                     </c>
                     <c cspan="2" ca="center">
                        <p>Interspecific divergence</p>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c cspan="3">
                        <hr/>
                     </c>
                     <c cspan="2">
                        <hr/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Gene</p>
                     </c>
                     <c ca="center">
                        <p>Sample size</p>
                     </c>
                     <c ca="center">
                        <p>Segregating sites</p>
                     </c>
                     <c ca="center">
                        <p>Silent sites</p>
                     </c>
                     <c ca="center">
                        <p>Differences</p>
                     </c>
                     <c ca="center">
                        <p>Sites</p>
                     </c>
                     <c ca="center">
                        <p>HKA <it>p</it>-value</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="7">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>DEFB1</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>94</p>
                     </c>
                     <c ca="center">
                        <p>22</p>
                     </c>
                     <c ca="center">
                        <p>1,400</p>
                     </c>
                     <c ca="center">
                        <p>79</p>
                     </c>
                     <c ca="center">
                        <p>1,313</p>
                     </c>
                     <c ca="center">
                        <p>-</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>ADAM19</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>94</p>
                     </c>
                     <c ca="center">
                        <p>12</p>
                     </c>
                     <c ca="center">
                        <p>2,000</p>
                     </c>
                     <c ca="center">
                        <p>99</p>
                     </c>
                     <c ca="center">
                        <p>1,904</p>
                     </c>
                     <c ca="center">
                        <p>0.11</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>CCL2</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>94</p>
                     </c>
                     <c ca="center">
                        <p>7</p>
                     </c>
                     <c ca="center">
                        <p>2,000</p>
                     </c>
                     <c ca="center">
                        <p>114</p>
                     </c>
                     <c ca="center">
                        <p>1,989</p>
                     </c>
                     <c ca="center">
                        <p>0.010</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>LMAN1</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>94</p>
                     </c>
                     <c ca="center">
                        <p>8</p>
                     </c>
                     <c ca="center">
                        <p>2,000</p>
                     </c>
                     <c ca="center">
                        <p>107</p>
                     </c>
                     <c ca="center">
                        <p>1,887</p>
                     </c>
                     <c ca="center">
                        <p>0.018</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>LY86</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>94</p>
                     </c>
                     <c ca="center">
                        <p>17</p>
                     </c>
                     <c ca="center">
                        <p>2,000</p>
                     </c>
                     <c ca="center">
                        <p>133</p>
                     </c>
                     <c ca="center">
                        <p>1,964</p>
                     </c>
                     <c ca="center">
                        <p>0.13</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>PTGDR</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>94</p>
                     </c>
                     <c ca="center">
                        <p>15</p>
                     </c>
                     <c ca="center">
                        <p>2,000</p>
                     </c>
                     <c ca="center">
                        <p>108</p>
                     </c>
                     <c ca="center">
                        <p>1,981</p>
                     </c>
                     <c ca="center">
                        <p>0.20</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>TGFA</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>94</p>
                     </c>
                     <c ca="center">
                        <p>8</p>
                     </c>
                     <c ca="center">
                        <p>2,000</p>
                     </c>
                     <c ca="center">
                        <p>83</p>
                     </c>
                     <c ca="center">
                        <p>1,974</p>
                     </c>
                     <c ca="center">
                        <p>0.074</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>TNFRSF18</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>94</p>
                     </c>
                     <c ca="center">
                        <p>14</p>
                     </c>
                     <c ca="center">
                        <p>2,000</p>
                     </c>
                     <c ca="center">
                        <p>184</p>
                     </c>
                     <c ca="center">
                        <p>1,602</p>
                     </c>
                     <c ca="center">
                        <p>0.0014</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>CCL11</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>94</p>
                     </c>
                     <c ca="center">
                        <p>13</p>
                     </c>
                     <c ca="center">
                        <p>2,000</p>
                     </c>
                     <c ca="center">
                        <p>137</p>
                     </c>
                     <c ca="center">
                        <p>1,967</p>
                     </c>
                     <c ca="center">
                        <p>0.038</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>CCL5</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>94</p>
                     </c>
                     <c ca="center">
                        <p>7</p>
                     </c>
                     <c ca="center">
                        <p>2,000</p>
                     </c>
                     <c ca="center">
                        <p>104</p>
                     </c>
                     <c ca="center">
                        <p>1,726</p>
                     </c>
                     <c ca="center">
                        <p>0.0077</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>EGF</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>94</p>
                     </c>
                     <c ca="center">
                        <p>10</p>
                     </c>
                     <c ca="center">
                        <p>2,000</p>
                     </c>
                     <c ca="center">
                        <p>96</p>
                     </c>
                     <c ca="center">
                        <p>1,851</p>
                     </c>
                     <c ca="center">
                        <p>0.061</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>EGFR</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>94</p>
                     </c>
                     <c ca="center">
                        <p>11</p>
                     </c>
                     <c ca="center">
                        <p>2,000</p>
                     </c>
                     <c ca="center">
                        <p>117</p>
                     </c>
                     <c ca="center">
                        <p>1,986</p>
                     </c>
                     <c ca="center">
                        <p>0.047</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>IL17E</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>94</p>
                     </c>
                     <c ca="center">
                        <p>10</p>
                     </c>
                     <c ca="center">
                        <p>2,000</p>
                     </c>
                     <c ca="center">
                        <p>101</p>
                     </c>
                     <c ca="center">
                        <p>1,978</p>
                     </c>
                     <c ca="center">
                        <p>0.066</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>IL17F</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>94</p>
                     </c>
                     <c ca="center">
                        <p>14</p>
                     </c>
                     <c ca="center">
                        <p>2,000</p>
                     </c>
                     <c ca="center">
                        <p>87</p>
                     </c>
                     <c ca="center">
                        <p>1,962</p>
                     </c>
                     <c ca="center">
                        <p>0.32</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>IRAK3</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>94</p>
                     </c>
                     <c ca="center">
                        <p>5</p>
                     </c>
                     <c ca="center">
                        <p>2,000</p>
                     </c>
                     <c ca="center">
                        <p>152</p>
                     </c>
                     <c ca="center">
                        <p>1,952</p>
                     </c>
                     <c ca="center">
                        <p>0.00032</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>IL18R1</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>94</p>
                     </c>
                     <c ca="center">
                        <p>12</p>
                     </c>
                     <c ca="center">
                        <p>2,000</p>
                     </c>
                     <c ca="center">
                        <p>103</p>
                     </c>
                     <c ca="center">
                        <p>1,901</p>
                     </c>
                     <c ca="center">
                        <p>0.095</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>IL23A</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>94</p>
                     </c>
                     <c ca="center">
                        <p>3</p>
                     </c>
                     <c ca="center">
                        <p>2,000</p>
                     </c>
                     <c ca="center">
                        <p>81</p>
                     </c>
                     <c ca="center">
                        <p>1,727</p>
                     </c>
                     <c ca="center">
                        <p>0.0030</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>MEFV</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>94</p>
                     </c>
                     <c ca="center">
                        <p>7</p>
                     </c>
                     <c ca="center">
                        <p>2,000</p>
                     </c>
                     <c ca="center">
                        <p>116</p>
                     </c>
                     <c ca="center">
                        <p>1,941</p>
                     </c>
                     <c ca="center">
                        <p>0.0081</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>TGFB2</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>94</p>
                     </c>
                     <c ca="center">
                        <p>7</p>
                     </c>
                     <c ca="center">
                        <p>2,000</p>
                     </c>
                     <c ca="center">
                        <p>75</p>
                     </c>
                     <c ca="center">
                        <p>1,960</p>
                     </c>
                     <c ca="center">
                        <p>0.073</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>TGFBR1</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>94</p>
                     </c>
                     <c ca="center">
                        <p>1</p>
                     </c>
                     <c ca="center">
                        <p>2,000</p>
                     </c>
                     <c ca="center">
                        <p>83</p>
                     </c>
                     <c ca="center">
                        <p>1,991</p>
                     </c>
                     <c ca="center">
                        <p>0.0011</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>TLR4</it>
                        </p>
                     </c>
                     <c ca="center">
                        <p>94</p>
                     </c>
                     <c ca="center">
                        <p>6</p>
                     </c>
                     <c ca="center">
                        <p>2,000</p>
                     </c>
                     <c ca="center">
                        <p>140</p>
                     </c>
                     <c ca="center">
                        <p>1,985</p>
                     </c>
                     <c ca="center">
                        <p>0.0014</p>
                     </c>
                  </r>
               </tblbdy>
            </tbl>
            <p>Another expectation for neutrally evolving genes is that values of &#952;<sub>W </sub>and &#960; are roughly equal; this is the case for the maximum values of innate immunity gene promoters but not for <it>DEFB1</it>, which shows greater &#960; than &#952;<sub>W</sub>, a finding consistent with an excess of intermediate frequency variants as a result of balancing selection <abbrgrp><abbr bid="B30">30</abbr></abbrgrp>. The statistics Tajima's D <abbrgrp><abbr bid="B31">31</abbr></abbrgrp> and Fu and Li's D* and F* <abbrgrp><abbr bid="B32">32</abbr></abbrgrp> are commonly used to evaluate the difference between &#952;<sub>W </sub>and &#960; and, therefore, to test departure from neutrality. As shown in Table <tblr tid="T1">1</tblr>, significantly positive values for the <it>DEFB1 </it>promoter of one or more statistics were obtained for all analyzed populations.</p>
            <p>It should be noted that population history, in addition to selective processes, is known <abbrgrp><abbr bid="B31">31</abbr></abbrgrp> to affect frequency spectra and, therefore, all related statistics such as Tajima's D and Fu and Li's D* and F*. In particular, positive values of the statistics are expected under a scenario of population contraction, while negative values are consistent with an increase in population size <abbrgrp><abbr bid="B31">31</abbr><abbr bid="B33">33</abbr></abbrgrp>. We performed all tests under the standard assumption of constant population size, which is unrealistic for human populations. Still, this approach is conservative when applied to African populations since they are thought to have undergone moderate but uninterrupted population expansion <abbrgrp><abbr bid="B34">34</abbr></abbrgrp>; in the case of non-African populations the effects of demography are more difficult to disentangle from balancing selection signatures since bottlenecks possibly occurred following migration out of Africa <abbrgrp><abbr bid="B34">34</abbr></abbrgrp>. One possibility to circumvent this problem is to exploit the fact that selection acts on a single locus while demography affects the whole genome. As shown in Table <tblr tid="T1">1</tblr>, Tajima's D, as well as Fu and Li's F* and D*, displays far higher values in the case of <it>DEFB1 </it>compared to the maximum values of innate immunity gene promoters in EA. In order to obtain a more extensive comparison, by including YRI and subjects of Asiatic ancestry we retrieved information concerning 231 genes resequenced in AA, EA, AS and YRI from the NIEHS SNPs Program (NIEHS panel 2) <abbrgrp><abbr bid="B35">35</abbr></abbrgrp>. In particular, for each gene a 5 kb region was randomly selected; the only requirement was that it did not contain any long (>500 bp) resequencing gaps, and if the gene did not fulfill this requirement it was discarded, as were 5 kb regions displaying less than six SNPs. The number of analyzed regions for AA, YRI, EA and AS were 209, 203, 177 and 172, respectively. We calculated the percentile rank of <it>DEFB1 </it>values in the distributions of Tajima's D and Fu and Li's F* and D* for this set of loci. In analogy to the results obtained above, values for <it>DEFB1 </it>ranked above the 95th percentile in all populations (except for Tajima's D in YRI, which ranked 93rd). It is worth mentioning that, as already noticed by other authors <abbrgrp><abbr bid="B36">36</abbr></abbrgrp>, resequenced genes in SNP discovery programs probably represent a sample biased toward non-neutrally evolving loci (in the case of the NIEHS SNPs Program, genes are selected on the basis of their having a role in organism-environment interactions), making comparison with their distribution a conservative test.</p>
            <p>A second possibility to disentangle the effect of demographic history from selection is to apply calibrated population genetics models. In particular, one such model that has been proposed recently, <it>cosi </it><abbrgrp><abbr bid="B37">37</abbr></abbrgrp>, is based on the ability to generate realistic data rather than relying on inference about population histories. We performed coalescent simulations using the <it>cosi </it>package <abbrgrp><abbr bid="B37">37</abbr></abbrgrp> and its best-fit population parameters for YRI, AA, EA and AS. Data are reported in Table <tblr tid="T1">1</tblr> and indicate that for Tajima's D, as well as for Fu and Li's D* and F*, application of a calibrated model allows rejection of neutrality for the four populations at the <it>DEFB1 </it>promoter region.</p>
            <p>Population genetic differentiation, quantified by F<sub>ST </sub><abbrgrp><abbr bid="B38">38</abbr></abbrgrp>, can also be used to detect the signature of balancing selection. In particular, lower F<sub>ST </sub>values are expected at loci under balancing selection compared to neutrally evolving ones <abbrgrp><abbr bid="B39">39</abbr><abbr bid="B40">40</abbr></abbrgrp>. F<sub>ST </sub>among AA, EA and AS was 0.0057, much lower than the genome average of 0.123 <abbrgrp><abbr bid="B40">40</abbr></abbrgrp> and not significantly different from 0 (<it>p </it>= 0.25).</p>
            <p>We next wished to verify that the evolution of the <it>DEFB1 </it>promoter is not influenced by the presence of a linked balanced polymorphism within, for example, the gene coding region. We exploited the availability of full resequencing data for the whole gene and calculated human-macaque divergence, nucleotide diversity, Tajima's D and F<sub>ST </sub>in sliding windows for AA and EA. As shown in Figure <figr fid="F1">1</figr>, while inter-specific divergence is quite homogeneous along <it>DEFB1</it>, a peak in nucleotide diversity (expecially &#960;) is observed at the promoter; consistently, in both AA and EA, the same region displays the maximum Tajima's D value and the minimum F<sub>ST</sub>, with no other region showing evidence suggestive of balancing selection.</p>
            <p>It should be noted that several defensin genes on 8p23.1, but not <it>DEFB1</it>, exhibit copy number variation (CNV) in humans <abbrgrp><abbr bid="B41">41</abbr></abbrgrp>; a more recent <abbrgrp><abbr bid="B42">42</abbr></abbrgrp> genome-wide analysis of CNVs indicated that the 5' gene region of <it>DEFB1 </it>might be encompassed by a CNV, although the authors indicate that, since the breakpoints are difficult to establish, involved loci might flank rather than be encompassed by the CNVs. The authors studied HapMap subjects and reported a frequency for the CNV ranging from 6% to 14% in different populations. Since our YRI samples comprise a subset of HapMap YRI subjects, we checked whether any of them were reported to display a CNV in this region: two subject were retrieved, accounting for one gain and one loss. Electropherograms of these two subjects (as well as all other subjects in this study) revealed no evidence of unbalanced peaks at heterozygous SNPs and their removal from the sample did not affect the results for YRI. Previous <abbrgrp><abbr bid="B43">43</abbr></abbrgrp> work had studied CNVs in the defensin cluster on chromosome 8 using real-time PCR assays and found that 24 American subjects with different ethnic origin had 2 copies of <it>DEFB1</it>. Taking these observations together, we consider that either <it>DEFB1 </it>lies outside the CNV or, in any case, that CNVs encompassing <it>DEFB1 </it>are very rare and do not affect the results reported here.</p>
         </sec>
         <sec>
            <st>
               <p>Haplotype analysis</p>
            </st>
            <p>One effect of balancing selection is to preserve two or more lineages over an extended period of time, resulting in clades separated by long branch lengths. To examine the genealogy of <it>DEFB1 </it>promoter haplotypes, we built a median-joining network. The topology of this network (Figure <figr fid="F2">2</figr>) is unambiguous with no reticulations, a pattern consistent with the low level of recombination observed in this gene region (not shown). Two major clades (haplogroups 1 and 2) separated by long branch lengths are evident, each containing one common haplotype. We next wished to estimate the time to the most recent common ancestor (TMRCA) of the two haplotype clades, applying a phylogeny-based method <abbrgrp><abbr bid="B44">44</abbr></abbrgrp> based on the measure &#961;, the average distance of descendant haplotypes from a specified root. By using root 1 (Figure <figr fid="F2">2</figr>), &#961; was equal to 9.45 so that, with a mutation rate based on 21 fixed differences between chimpanzee and humans and a separation time of 5 million years ago, we estimated a TMRCA of 4,489,791 years (standard deviation &#177;1,018,128).</p>
            <fig id="F2">
               <title>
                  <p>Figure 2</p>
               </title>
               <caption>
                  <p>Genealogy of <it>DEFB1 </it>haplotypes reconstructed through a median-joining network</p>
               </caption>
               <text>
                  <p>Genealogy of <it>DEFB1 </it>haplotypes reconstructed through a median-joining network. Each node represents a different haplotype, with the size of the circle proportional to the haplotype frequency. Also, circles are color-coded according to population (green, AA; black, YRI; blue, EA; yellow, AS; red, SAI; gray, AUA). The red arrow indicates root 1 (see text). Nucleotide differences between haplotypes are indicated on the branches of the network. The orangutan sequence is also shown.</p>
               </text>
               <graphic file="gb-2008-9-9-r143-2"/>
            </fig>
         </sec>
         <sec>
            <st>
               <p>Comparison with other primates</p>
            </st>
            <p>In order to gain further insight into the evolutionary history of the <it>DEFB1 </it>promoter region, we resequenced those from three chimpanzees and one orangutan. These samples were obtained from the European Collection of Cell Cultures and the <it>Pongo </it>sequence was used in the median-joining network in order to root the phylogeny (Figure <figr fid="F2">2</figr>). A total of 5 polymorphic sites were identified in chimpanzees; one of them (-913 C/T in the human sequence) was shared with humans and, therefore, represents a <it>trans</it>-specific polymorphism. <it>Trans</it>-specific polymorphisms are an effect of long-term balancing selection, while they are highly unlikely under neutrality. Indeed, a neutral polymorphism is expected to persist for 4N<sub>e </sub>generations (where N<sub>e </sub>is the effective population size, estimated to be around 10,000 for humans) <abbrgrp><abbr bid="B45">45</abbr></abbrgrp> and, therefore, the probability of observing a polymorphism shared between humans and chimpanzees, two species that diverged about 5 million years ago (around 20N<sub>e </sub>generations), is extremely low <abbrgrp><abbr bid="B46">46</abbr><abbr bid="B47">47</abbr></abbrgrp>. Although the identification of a human/chimpanzee <it>trans</it>-specific SNP is consistent with the estimated TMRCA of the haplotype clusters (suggesting that balancing selection was established around the same time when the human and <it>Pan </it>lineages split), the possibility exists that the shared SNP is due to a coincidental mutation that occurred after speciation. Indeed, the location of the substitution at a CpG site makes the possibility of a recurrent mutation more likely and, therefore, taking into account the lack of functional data on this SNP, it is difficult to discriminate between the two possibilities.</p>
         </sec>
      </sec>
      <sec>
         <st>
            <p>Discussion</p>
         </st>
         <p>Haldane's hypothesis <abbrgrp><abbr bid="B48">48</abbr></abbrgrp> as formulated in 1932 posits that infectious diseases have been a major threat to human populations and have, therefore, exerted strong selective pressures throughout human history. As a result, a number of human loci are thought to have evolved in response to such pressures. Up to now, most evolutionary studies have focused on adaptive immunity, yet the ancient innate immune system, with the production of antimicrobial peptides, provides a critical line of defense in vertebrates <abbrgrp><abbr bid="B5">5</abbr></abbrgrp>. Following Haldane's idea, it is conceivable, therefore, that innate immunity genes have undergone similar selective pressures as their adaptive counterparts. Indeed, in analogy to immunoglobulins <abbrgrp><abbr bid="B49">49</abbr></abbrgrp> and major histocompatibility complex (MHC) molecules <abbrgrp><abbr bid="B50">50</abbr></abbrgrp>, the paradigm whereby gene duplication followed by rapid divergence has been a powerful adaptive strategy in immune response genes has been verified for defensin loci <abbrgrp><abbr bid="B6">6</abbr><abbr bid="B7">7</abbr><abbr bid="B51">51</abbr></abbrgrp>. Recent studies <abbrgrp><abbr bid="B7">7</abbr></abbrgrp> demonstrated that, after gene duplication in an ancestral mammalian genome, the mature peptide-coding exons of &#946;-defensins have been subjected to positive selection, while sites within the pre-propeptide region have undergone negative selection in primate lineages.</p>
         <p>The data we report add further complexity to the evolutionary history of defensin genes by showing that balancing selection has shaped variability at the promoter region of human <it>DEFB1</it>. Indeed, we have documented here that the <it>DEFB1 </it>promoter region displays elevated nucleotide diversity, excess of polymorphism to divergence levels and reduced population differentiation. In line with these findings, the analysis of <it>DEFB1 </it>haplotypes revealed the presence of two clades separated by long branches approximately dating back to the time when the human and chimpanzee lineages split. Altogether, these features represent strong molecular signatures of long-term balancing selection, a process that is thought to be extremely rare outside MHC genes <abbrgrp><abbr bid="B47">47</abbr></abbrgrp>.</p>
         <p>&#946;-Defensin 1, the first human &#946;-defensin to be discovered, shows anti-bacterial activity against a wide range of Gram-negative bacteria (for example, <it>Escherichia coli</it>, <it>Pseudomonas aeruginosa</it>, and <it>Klebsiella pneumoniae</it>), as well as different <it>Candida </it>species <abbrgrp><abbr bid="B52">52</abbr><abbr bid="B53">53</abbr><abbr bid="B54">54</abbr></abbrgrp>. &#946;-defensin 1 is constitutively expressed by most epithelia with higher levels being detectable in kidney, pancreas, the urogenital and respiratory tracts <abbrgrp><abbr bid="B54">54</abbr><abbr bid="B55">55</abbr><abbr bid="B56">56</abbr></abbrgrp>. Consistently, targeted disruption of the mouse &#946;-defensin 1 gene resulted in animals deficient in the clearance of <it>Haemophilus influenzae </it>from the lung <abbrgrp><abbr bid="B57">57</abbr></abbrgrp> or containing a greater number of bacteria (Staphylococci, in particular) in urine collected from the bladder <abbrgrp><abbr bid="B58">58</abbr></abbrgrp>. Also, <it>DEFB1 </it>expression has been demonstrated <abbrgrp><abbr bid="B59">59</abbr><abbr bid="B60">60</abbr><abbr bid="B61">61</abbr></abbrgrp> in the human epidermis, gingival epithelium, oral mucosa and saliva, suggesting that it contributes to host defenses in areas exposed to a variety of microbial challenges. Moreover, recent evidences indicated that the protein product of <it>DEFB1 </it>is detectable in human milk <abbrgrp><abbr bid="B62">62</abbr></abbrgrp> and the mammary epithelium <abbrgrp><abbr bid="B63">63</abbr></abbrgrp>; in particular, pregnant women display higher levels of &#946;-defensin 1 and concentrations comparable to those observed in milk were effective in killing <it>E. coli </it><abbrgrp><abbr bid="B62">62</abbr></abbrgrp>, suggesting that this antimicrobial peptide might have a fundamental role in protecting breast-fed infants from infectious diarrhea and mothers from lactational mastitis <abbrgrp><abbr bid="B62">62</abbr><abbr bid="B63">63</abbr></abbrgrp>.</p>
         <p>The promoter region of <it>DEFB1 </it>has recently been subjected to extensive study; in particular, three SNPs have been reported to affect gene expression <abbrgrp><abbr bid="B17">17</abbr><abbr bid="B64">64</abbr></abbrgrp>, although contrasting results on transcriptional activity have been obtained by different research groups, possibly reflecting either non-trivial interactions among polymorphic alleles at multiple positions or cell-type specific SNP effects <abbrgrp><abbr bid="B65">65</abbr></abbrgrp>. In SNP typing studies, the -20A/-44C/-52G haplotype has been independently associated with protection against severe sepsis <abbrgrp><abbr bid="B13">13</abbr></abbrgrp>, susceptibility to asthma and atopy <abbrgrp><abbr bid="B12">12</abbr></abbrgrp> and, in cystic fibrosis patients, with chronic <it>P. aeruginosa </it>lung infection <abbrgrp><abbr bid="B66">66</abbr></abbrgrp>. Also, the -44C allele was shown to predispose to HIV <abbrgrp><abbr bid="B14">14</abbr><abbr bid="B15">15</abbr></abbrgrp> and <it>Candida </it><abbrgrp><abbr bid="B16">16</abbr></abbrgrp> infection, while an association with HIV infection in Brazilian children was also reported for SNPs -20G and -52A <abbrgrp><abbr bid="B15">15</abbr></abbrgrp>. Although the biological bases for these associations are presently unknown, their description allows interesting speculations concerning the selective pressures possibly shaping nucleotide diversity at the <it>DEFB1 </it>promoter region. Sepsis is a leading cause of death in infants and children throughout the world <abbrgrp><abbr bid="B67">67</abbr></abbrgrp>; its incidence and fatal outcome were conceivably higher before the advent of modern sanitation and, therefore, it might have represented a powerful selective force during human history. Indeed, signatures of natural selection have been reported at another human locus, namely <it>CASP12 </it><abbrgrp><abbr bid="B68">68</abbr></abbrgrp>, as a possible adaptive response to sepsis. Variants in the <it>DEFB1 </it>promoter that protect against sepsis might, therefore, have conferred a selective advantage to carriers, although one or more of these same SNP alleles have been associated with predisposition to candidiasis <abbrgrp><abbr bid="B16">16</abbr></abbrgrp>, as well as to susceptibility to HIV and <it>P. aeruginosa </it>infection (at least in cystic fibrosis patients) <abbrgrp><abbr bid="B14">14</abbr><abbr bid="B15">15</abbr><abbr bid="B66">66</abbr></abbrgrp>. In this respect, it is interesting to notice that early hunter-gatherer societies, due to their small population sizes, were likely to support a parasite fauna constituted of pathogens with high transmission rates and inducing little or no immunity <abbrgrp><abbr bid="B69">69</abbr></abbrgrp>. In such a scenario, the role of innate response might have been extremely relevant to ensure protection from infectious agents. The increase in population size that occurred at some time during human history is thought to have allowed maintenance of a different and wider range of pathogen species, including major infectious agents responsible for sepsis. Variable environmental conditions are regarded as a possible explanation underlying the maintenance of balanced polymorphisms <abbrgrp><abbr bid="B70">70</abbr></abbrgrp>; in a simplistic situation whereby a variant (or haplotype) protects against sepsis while predisposing to other infectious agents, changes in pathogen prevalence, with particular reference to microbes leading to fatal sepsis, might modulate the fitness of subjects carrying either allele.</p>
         <p>Unfortunately, little information is available concerning the early epidemiological history of our predecessors; indeed, the timing of human population expansion has been matter of debate <abbrgrp><abbr bid="B71">71</abbr><abbr bid="B72">72</abbr><abbr bid="B73">73</abbr></abbrgrp> and some uncertainty concerns the time of origin of major human pathogens, for example, tuberculosis <abbrgrp><abbr bid="B74">74</abbr><abbr bid="B75">75</abbr></abbrgrp>. Further studies concerning these issues, as well as better understanding of the role of <it>DEFB1 </it>polymorphisms, will therefore be required before a direct link can be established between pathogen-driven selective pressure and the maintenance of <it>DEFB1 </it>variants.</p>
         <p>An additional, non-mutually exclusive possibility to explain the action of balancing selection at the <it>DEFB1 </it>promoter implies heterozygote advantage. This phenomenon is deemed responsible for maintenance of polymorphisms at MHC class II promoters <abbrgrp><abbr bid="B10">10</abbr><abbr bid="B76">76</abbr></abbrgrp> and is thought to enhance immune response flexibility by modulating allele-specific gene expression in different cell-types <abbrgrp><abbr bid="B77">77</abbr></abbrgrp> and in response to diverse stimuli/cytokines <abbrgrp><abbr bid="B78">78</abbr></abbrgrp>. <it>DEFB1 </it>is considered a constitutive defensin, in that, unlike &#946;-defensin 2, it shows limited inducibility by inflammatory stimuli (reviewed in <abbrgrp><abbr bid="B5">5</abbr></abbrgrp>); however, previous reports have indicated that <it>DEFB1 </it>shows marked inter-individual variability in expression levels in urine, saliva, gingival epithelium and epidermis <abbrgrp><abbr bid="B56">56</abbr><abbr bid="B59">59</abbr><abbr bid="B60">60</abbr><abbr bid="B61">61</abbr></abbrgrp>. Similarly, the ability of lipopolysaccharide to induce <it>DEFB1 </it>expression varied among the blood samples obtained from 51 healthy individuals <abbrgrp><abbr bid="B53">53</abbr></abbrgrp>. These data, together with the functional data indicating allele-dependent promoter activity in different cell types <abbrgrp><abbr bid="B64">64</abbr><abbr bid="B65">65</abbr></abbrgrp>, suggest that <it>DEFB1 </it>variants might exert different effects in diverse tissues, possibly accounting both for inter-individual variation of expression levels and for maintenance of divergent clades.</p>
         <p>It might also be worth mentioning that evidence, albeit preliminary, indicates that <it>DEFB1 </it>expression is up-regulated during pregnancy <abbrgrp><abbr bid="B56">56</abbr><abbr bid="B62">62</abbr></abbrgrp>, suggesting hormone-regulated gene expression. No data have ever been reported concerning the response of different <it>DEFB1 </it>promoter haplotypes to hormone treatment; were any difference identified, the adaptive significance of variants increasing expression in human milk, for example, would be evident.</p>
         <p>Finally, it might be interesting to note that, given its high expression in urogenital tissues, <it>DEFB1 </it>has been regarded as a possible innate defense against sexually transmitted pathogens <abbrgrp><abbr bid="B56">56</abbr></abbrgrp>. In line with this view, induction of an antiviral response in cultured uterine epithelial cells resulted in a six-fold increase in <it>DEFB1 </it>expression <abbrgrp><abbr bid="B79">79</abbr></abbrgrp>. Since sexually transmitted diseases are thought to have affected early hominid societies, due to their sustainability in low-density host population <abbrgrp><abbr bid="B69">69</abbr></abbrgrp>, these observation might help to explain the ancient origin of <it>DEFB1 </it>haplotype clades.</p>
         <p>As discussed in the introduction, two recent reports indicated that balancing selection has shaped variability at the promoter region of other loci involved in immune response. In the case of <it>CCR5</it>, available evidence indicates that heterozygosity at this gene region delays HIV-1 disease progression <abbrgrp><abbr bid="B80">80</abbr></abbrgrp>. However, as the authors note, the introduction of HIV-1 in human populations is relatively recent and cannot, therefore, account for the maintenance of balanced polymorphisms in the region; therefore, <it>CCR5 </it>possibly evolved to respond to older pathogens, providing a clue to the difficult task of inferring the origin of selective pressures exerted by human pathogens over long evolutionary times.</p>
         <p>Whatever the reason for the maintenance of a balanced variant, it is interesting to note that variation at <it>DEFB1 </it>might fit a previously proposed hypothesis <abbrgrp><abbr bid="B81">81</abbr></abbrgrp> whereby alleles that conferred resistance to pathogens in ancient settings are now associated with susceptibility to atopic disorders; <it>DEFB1 </it>haplotypes associated with protection against sepsis seem to predispose to asthma and atopy. A similar link between past selection and present disease predisposition has been suggested <abbrgrp><abbr bid="B82">82</abbr></abbrgrp> in the case of polymorphic variants in the <it>IL4RA </it>gene and might help to explain the high prevalence of atopic conditions in modern societies.</p>
      </sec>
      <sec>
         <st>
            <p>Conclusion</p>
         </st>
         <p>Association studies of <it>DEFB1 </it>variants have focused on a small number of SNPs to be genotyped; it is possible, therefore, that additional variants in this gene region play a role in the above described (or still unknown) conditions. In this regard, it is worth mentioning that the availability of full gene resequencing data allowed us to define a specific <it>DEFB1 </it>gene region as the target of balancing selection and, therefore, as the location of functional variants. This information might be valuable in future association studies, suggesting that <it>DEFB1 </it>promoter SNPs, rather than linked variants, associate with specific phenotypes.</p>
         <p>This report represents an example of how population genetics approaches may benefit from association studies by gaining cues about possible selective pressures acting on target gene regions; we hope it also illustrates the possible contribution of evolutionary models to classic SNP-disease association approaches by providing information about the localization of candidate functional variants.</p>
      </sec>
      <sec>
         <st>
            <p>Materials and methods</p>
         </st>
         <sec>
            <st>
               <p>DNA samples and sequencing</p>
            </st>
            <p>Human genomic DNA was obtained from the European Collection of Cell Cultures (Ethnic Diversity DNA Panel plus additional samples for Australian Aborigine derived from HLA defined panels). From the same source we obtained the genomic DNA of three chimpanzees (<it>Pan troglodytes</it>) and one orangutan (<it>Pongo pygmaeus</it>). Additional DNA samples from South American Indians and Yoruba individuals were derived from the Coriell Institute for Medical Research.</p>
            <p>The 1.4 kb region covering the promoter region of <it>DEFB1 </it>was PCR amplified (primer sequences are reported in Table <tblr tid="T3">3</tblr>). PCR products were treated with ExoSAP-IT (USB Corporation, Cleveland, OH, USA), directly sequenced on both strands with a Big Dye Terminator sequencing Kit (v3.1 Applied Biosystems, Monza, Italy) and run on an Applied Biosystems ABI 3130 XL Genetic Analyzer. All sequences were assembled using AutoAssembler version 1.4.0 (Applied Biosystems), inspected manually by two distinct operators, and singletons were re-amplified and resequenced.</p>
            <tbl id="T3">
               <title>
                  <p>Table 3</p>
               </title>
               <caption>
                  <p>Primer sequences</p>
               </caption>
               <tblbdy cols="3">
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>Forward primers</p>
                     </c>
                     <c ca="left">
                        <p>Reverse primers</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="3">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>H</p>
                     </c>
                     <c ca="left">
                        <p>DEFB1-F1:CAATCTCACTGCTCCTAGGTC</p>
                     </c>
                     <c ca="left">
                        <p>DEFB1-R1:CAGGAATGACATCCACCCTAC</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>DEFB1-F2:CTGCCAGCGGTAGAGTGGC</p>
                     </c>
                     <c ca="left">
                        <p>DEFB1-R2:CTGGTGCCAGCTCCTCCTG</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>DEFB1-F3:CTCCAGTGTGAACTGCCTG</p>
                     </c>
                     <c ca="left">
                        <p>DEFB1-R3:CTTGCCTGCTGCCTTCTGC</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>C</p>
                     </c>
                     <c ca="left">
                        <p>DEFB1-C-F1:CAATCTTATTGAACCCACAC</p>
                     </c>
                     <c ca="left">
                        <p>DEFB1-C-R1:CAAGTATTCCTCAGGTTTTC</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>DEFB1-C-F2:CTGCCAGGGGTAGAGTGGC</p>
                     </c>
                     <c ca="left">
                        <p>DEFB1-C-R2:CTGGGGCCAGCTCCTCCTG</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>DEFB1-C-F3:GGATTCCAGTGTGAACTGCC</p>
                     </c>
                     <c ca="left">
                        <p>DEFB1-R3:CTTGCCTGCTGCCTTCTGC</p>
                     </c>
                  </r>
               </tblbdy>
               <tblfn>
                  <p>Primers used for amplification of human (H) and chimpanzee (C) templates.</p>
               </tblfn>
            </tbl>
         </sec>
         <sec>
            <st>
               <p>Data retrieval and haplotype construction</p>
            </st>
            <p><it>DEFB1 </it>genotype data for American subjects of either African or European descent were retrieved from the IIPGA website <abbrgrp><abbr bid="B19">19</abbr></abbrgrp>. From the same source, we derived resequencing data referring to promoter regions (2 kb upstream of the translation initiation site) of other innate immunity genes genotyped for AA and EA. Promoter regions were not selected if the initial ATG was not located in the first exon (as it is for <it>DEFB1</it>) or if it could not be unequivocally identified due to the presence of multiple 5' isoforms, which were identified through manual inspection of UCSC annotation tracks <abbrgrp><abbr bid="B83">83</abbr></abbrgrp>. Also, promoter regions were discarded if located in recombination hotspots (these were manually identified through the UCSC genome annotation tables snpRecombHotspotHapmap and snpRecombHotspotPerlegen <abbrgrp><abbr bid="B83">83</abbr></abbrgrp>) or in resequencing gaps. A total of 20 promoter regions finally constituted the control dataset.</p>
            <p>Genotype data for 231 resequenced human genes were derived from the NIEHS SNPs Program web site <abbrgrp><abbr bid="B35">35</abbr></abbrgrp>. In particular, we selected genes that had been resequenced in populations of defined ethnicity, including Asians (NIEHS panel 2).</p>
            <p>Haplotypes were inferred using PHASE version 2.1 <abbrgrp><abbr bid="B20">20</abbr><abbr bid="B21">21</abbr></abbrgrp>, a program for reconstructing haplotypes from unrelated genotype data through a Bayesian statistical method. Haplotypes for AS, AUA, SAI and YRI individuals are available as supporting information (Additional data file 1).</p>
         </sec>
         <sec>
            <st>
               <p>Statistical analysis</p>
            </st>
            <p>Tajima's D <abbrgrp><abbr bid="B31">31</abbr></abbrgrp>, Fu and Li's D* and F* <abbrgrp><abbr bid="B32">32</abbr></abbrgrp> statistics, as well as diversity parameters &#952;<sub>W </sub><abbrgrp><abbr bid="B22">22</abbr></abbrgrp> and &#960; <abbrgrp><abbr bid="B23">23</abbr></abbrgrp> were calculated using <it>libsequence </it><abbrgrp><abbr bid="B84">84</abbr></abbrgrp>, a C++ class library providing an object-oriented framework for the analysis of molecular population genetic data. Departure from neutrality was tested from coalescent simulations computed with <it>ms </it>software <abbrgrp><abbr bid="B85">85</abbr></abbrgrp> fixing the mutation parameter, assuming no intra-locus recombination and a constant population size with 100,000 iterations. Calibrated coalescent simulations were performed using the <it>cosi </it>package <abbrgrp><abbr bid="B37">37</abbr></abbrgrp> and its best-fit parameters for YRI, AA, EA and AS populations with 10,000 iterations. The F<sub>ST </sub>statistic <abbrgrp><abbr bid="B38">38</abbr></abbrgrp> estimates genetic differentiation among populations and was calculated as proposed by Hudson <it>et al</it>. <abbrgrp><abbr bid="B86">86</abbr></abbrgrp>. Significance was assessed by permuting 10,000 times the haplotype distribution among populations <abbrgrp><abbr bid="B87">87</abbr></abbrgrp>.</p>
            <p>Pairwise HKA tests were performed using <it>libsequence</it>. The maximum-likelihood-ratio HKA test was performed using the MLHKA software <abbrgrp><abbr bid="B27">27</abbr></abbrgrp> with multilocus data of 20 selected IIPGA promoter regions and <it>Rhesus macaque </it>(NCBI rheMac2) as an outgroup. In particular, we evaluated the likelihood of the model under two different assumptions: that all loci evolved neutrally and that only the <it>DEFB1 </it>promoter region was subjected to natural selection; statistical significance was assessed by a likelihood ratio test. We used a chain length (the number of cycles of the Markov chain) of 500,000 and, as suggested by the authors, we ran the program several times with different seeds to ensure stability of results.</p>
            <p>In order to test for gene conversion events, we applied Sawyer's gene conversion algorithm <abbrgrp><abbr bid="B24">24</abbr></abbrgrp> implemented in the GENECONV program. GENECONV assesses significance using two methods: permutations and an approximate <it>p</it>-value <abbrgrp><abbr bid="B88">88</abbr><abbr bid="B89">89</abbr></abbrgrp>. We performed several tests by varying the mismatch penalty from 0 to larger positive values and using 10,000 permutations. For all these runs and both methods, no pairwise or global <it>p</it>-value involving <it>DEFB1 </it>was significant, suggesting no inner or outer fragments showing past gene conversion.</p>
            <p>The median-joining network to infer haplotype genealogy was constructed using NETWORK 4.2 <abbrgrp><abbr bid="B44">44</abbr></abbrgrp>. The time to the most common ancestor (TMRCA) was estimated using a phylogeny based approach implemented in NETWORK 4.2 using a mutation rate based on 21 fixed differences between chimpanzee and humans in the 1.4 kb <it>DEFB1 </it>region.</p>
            <p>All calculations were performed in the R environment <abbrgrp><abbr bid="B90">90</abbr></abbrgrp>.</p>
         </sec>
      </sec>
      <sec>
         <st>
            <p>Abbreviations</p>
         </st>
         <p>AA, African American; AS, Asian; AUA, Australian Aborigine; CNV, copy number variation; EA, European American; IIPGA, Innate Immunity PGA; MHC, major histocompatibility complex; SAI, South American Indian; SNP, single nucleotide polymorphism; TMRCA, time to the most recent common ancestor; YRI, Yorubans.</p>
      </sec>
      <sec>
         <st>
            <p>Authors' contributions</p>
         </st>
         <p>RC and SR performed all resequencing experiments and analyzed the data. MF and GM retrieved genotype data and performed population genetics analyses. MS, MF, RC, GPC and UP analyzed and interpreted the data. NB participated in the study coordination. MS and MF wrote the paper. MS conceived and coordinated the study.</p>
      </sec>
      <sec>
         <st>
            <p>Additional data files</p>
         </st>
         <p>The following additional data are available. Additional data file <supplr sid="S1">1</supplr> is a spreadsheet reporting the <it>DEFB1 </it>promoter haplotypes for the following subjects: 22 YRI, 25 AS, 24 SAI and 12 AUA. SNP positions refer to the NCBI Build 36.1 assembly.</p>
         <suppl id="S1">
            <title>
               <p>Additional data file 1</p>
            </title>
            <caption>
               <p><it>DEFB1 </it>promoter haplotypes</p>
            </caption>
            <text>
               <p><it>DEFB1 </it>promoter haplotypes are reported for AS, AUA, SAI and YRI.</p>
            </text>
            <file name="gb-2008-9-9-r143-S1.xls">
               <p>Click here for file</p>
            </file>
         </suppl>
      </sec>
   </bdy>
   <bm>
      <ack>
         <sec>
            <st>
               <p>Acknowledgements</p>
            </st>
            <p>We are grateful to Roberto Giorda for helpful discussions about the manuscript.</p>
         </sec>
      </ack>
      <refgrp>
         <bibl id="B1">
            <title>
               <p>Gene-encoded peptide antibiotics and the concept of innate immunity: an update review.</p>
            </title>
            <aug>
               <au>
                  <snm>Boman</snm>
                  <fnm>HG</fnm>
               </au>
            </aug>
            <source>Scand J Immunol</source>
            <pubdate>1998</pubdate>
            <volume>48</volume>
            <fpage>15</fpage>
            <lpage>25</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1046/j.1365-3083.1998.00343.x</pubid>
                  <pubid idtype="pmpid" link="fulltext">9714406</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B2">
            <title>
               <p>Defensins of vertebrate animals.</p>
            </title>
            <aug>
               <au>
                  <snm>Lehrer</snm>
                  <fnm>RI</fnm>
               </au>
               <au>
                  <snm>Ganz</snm>
                  <fnm>T</fnm>
               </au>
            </aug>
            <source>Curr Opin Immunol</source>
            <pubdate>2002</pubdate>
            <volume>14</volume>
            <fpage>96</fpage>
            <lpage>102</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/S0952-7915(01)00303-X</pubid>
                  <pubid idtype="pmpid" link="fulltext">11790538</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B3">
            <title>
               <p>Mammalian defensins in immunity: more than just microbicidal.</p>
            </title>
            <aug>
               <au>
                  <snm>Yang</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Biragyn</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Kwak</snm>
                  <fnm>LW</fnm>
               </au>
               <au>
                  <snm>Oppenheim</snm>
                  <fnm>JJ</fnm>
               </au>
            </aug>
            <source>Trends Immunol</source>
            <pubdate>2002</pubdate>
            <volume>23</volume>
            <fpage>291</fpage>
            <lpage>296</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/S1471-4906(02)02246-9</pubid>
                  <pubid idtype="pmpid" link="fulltext">12072367</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B4">
            <title>
               <p>Multiple roles of antimicrobial defensins, cathelicidins, and eosinophil-derived neurotoxin in host defense.</p>
            </title>
            <aug>
               <au>
                  <snm>Yang</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Biragyn</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Hoover</snm>
                  <fnm>DM</fnm>
               </au>
               <au>
                  <snm>Lubkowski</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Oppenheim</snm>
                  <fnm>JJ</fnm>
               </au>
            </aug>
            <source>Annu Rev Immunol</source>
            <pubdate>2004</pubdate>
            <volume>22</volume>
            <fpage>181</fpage>
            <lpage>215</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1146/annurev.immunol.22.012703.104603</pubid>
                  <pubid idtype="pmpid" link="fulltext">15032578</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B5">
            <title>
               <p>Mammalian defensins in the antimicrobial immune response.</p>
            </title>
            <aug>
               <au>
                  <snm>Selsted</snm>
                  <fnm>ME</fnm>
               </au>
               <au>
                  <snm>Ouellette</snm>
                  <fnm>AJ</fnm>
               </au>
            </aug>
            <source>Nat Immunol</source>
            <pubdate>2005</pubdate>
            <volume>6</volume>
            <fpage>551</fpage>
            <lpage>557</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1038/ni1206</pubid>
                  <pubid idtype="pmpid" link="fulltext">15908936</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B6">
            <title>
               <p>Duplication and selection in the evolution of primate beta-defensin genes.</p>
            </title>
            <aug>
               <au>
                  <snm>Semple</snm>
                  <fnm>CA</fnm>
               </au>
               <au>
                  <snm>Rolfe</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Dorin</snm>
                  <fnm>JR</fnm>
               </au>
            </aug>
            <source>Genome Biol</source>
            <pubdate>2003</pubdate>
            <volume>4</volume>
            <fpage>R31</fpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">156587</pubid>
                  <pubid idtype="pmpid" link="fulltext">12734011</pubid>
                  <pubid idtype="doi">10.1186/gb-2003-4-5-r31</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B7">
            <title>
               <p>The complexity of selection at the major primate beta-defensin locus.</p>
            </title>
            <aug>
               <au>
                  <snm>Semple</snm>
                  <fnm>CA</fnm>
               </au>
               <au>
                  <snm>Maxwell</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Gautier</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Kilanowski</snm>
                  <fnm>FM</fnm>
               </au>
               <au>
                  <snm>Eastwood</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Barran</snm>
                  <fnm>PE</fnm>
               </au>
               <au>
                  <snm>Dorin</snm>
                  <fnm>JR</fnm>
               </au>
            </aug>
            <source>BMC Evol Biol</source>
            <pubdate>2005</pubdate>
            <volume>5</volume>
            <fpage>32</fpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">1156880</pubid>
                  <pubid idtype="pmpid" link="fulltext">15904491</pubid>
                  <pubid idtype="doi">10.1186/1471-2148-5-32</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B8">
            <title>
               <p>A strong signature of balancing selection in the 5' cis-regulatory region of CCR5.</p>
            </title>
            <aug>
               <au>
                  <snm>Bamshad</snm>
                  <fnm>MJ</fnm>
               </au>
               <au>
                  <snm>Mummidi</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Gonzalez</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Ahuja</snm>
                  <fnm>SS</fnm>
               </au>
               <au>
                  <snm>Dunn</snm>
                  <fnm>DM</fnm>
               </au>
               <au>
                  <snm>Watkins</snm>
                  <fnm>WS</fnm>
               </au>
               <au>
                  <snm>Wooding</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Stone</snm>
                  <fnm>AC</fnm>
               </au>
               <au>
                  <snm>Jorde</snm>
                  <fnm>LB</fnm>
               </au>
               <au>
                  <snm>Weiss</snm>
                  <fnm>RB</fnm>
               </au>
               <au>
                  <snm>Ahuja</snm>
                  <fnm>SK</fnm>
               </au>
            </aug>
            <source>Proc Natl Acad Sci USA</source>
            <pubdate>2002</pubdate>
            <volume>99</volume>
            <fpage>10539</fpage>
            <lpage>10544</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">124967</pubid>
                  <pubid idtype="pmpid" link="fulltext">12149450</pubid>
                  <pubid idtype="doi">10.1073/pnas.162046399</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B9">
            <title>
               <p>Evidence of balancing selection at the HLA-G promoter region.</p>
            </title>
            <aug>
               <au>
                  <snm>Tan</snm>
                  <fnm>Z</fnm>
               </au>
               <au>
                  <snm>Shon</snm>
                  <fnm>AM</fnm>
               </au>
               <au>
                  <snm>Ober</snm>
                  <fnm>C</fnm>
               </au>
            </aug>
            <source>Hum Mol Genet</source>
            <pubdate>2005</pubdate>
            <volume>14</volume>
            <fpage>3619</fpage>
            <lpage>3628</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1093/hmg/ddi389</pubid>
                  <pubid idtype="pmpid" link="fulltext">16236759</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B10">
            <title>
               <p>Ancient polymorphism and functional variation in the primate MHC-DQA1 5' cis-regulatory region.</p>
            </title>
            <aug>
               <au>
                  <snm>Loisel</snm>
                  <fnm>DA</fnm>
               </au>
               <au>
                  <snm>Rockman</snm>
                  <fnm>MV</fnm>
               </au>
               <au>
                  <snm>Wray</snm>
                  <fnm>GA</fnm>
               </au>
               <au>
                  <snm>Altmann</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Alberts</snm>
                  <fnm>SC</fnm>
               </au>
            </aug>
            <source>Proc Natl Acad Sci USA</source>
            <pubdate>2006</pubdate>
            <volume>103</volume>
            <fpage>16331</fpage>
            <lpage>16336</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">1637582</pubid>
                  <pubid idtype="pmpid" link="fulltext">17053068</pubid>
                  <pubid idtype="doi">10.1073/pnas.0607662103</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B11">
            <title>
               <p>An ancient balanced polymorphism in a regulatory region of human major histocompatibility complex is retained in Chinese minorities but lost worldwide.</p>
            </title>
            <aug>
               <au>
                  <snm>Liu</snm>
                  <fnm>X</fnm>
               </au>
               <au>
                  <snm>Fu</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Liu</snm>
                  <fnm>Z</fnm>
               </au>
               <au>
                  <snm>Lin</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Xie</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Liu</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Xu</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Lin</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Fan</snm>
                  <fnm>X</fnm>
               </au>
               <au>
                  <snm>Dong</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Zeng</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Wu</snm>
                  <fnm>CI</fnm>
               </au>
               <au>
                  <snm>Xu</snm>
                  <fnm>A</fnm>
               </au>
            </aug>
            <source>Am J Hum Genet</source>
            <pubdate>2006</pubdate>
            <volume>78</volume>
            <fpage>393</fpage>
            <lpage>400</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">1380283</pubid>
                  <pubid idtype="pmpid" link="fulltext">16465617</pubid>
                  <pubid idtype="doi">10.1086/500593</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B12">
            <title>
               <p>Asthma and atopy are associated with DEFB1 polymorphisms in Chinese children.</p>
            </title>
            <aug>
               <au>
                  <snm>Leung</snm>
                  <fnm>TF</fnm>
               </au>
               <au>
                  <snm>Li</snm>
                  <fnm>CY</fnm>
               </au>
               <au>
                  <snm>Liu</snm>
                  <fnm>EK</fnm>
               </au>
               <au>
                  <snm>Tang</snm>
                  <fnm>NL</fnm>
               </au>
               <au>
                  <snm>Chan</snm>
                  <fnm>IH</fnm>
               </au>
               <au>
                  <snm>Yung</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Wong</snm>
                  <fnm>GW</fnm>
               </au>
               <au>
                  <snm>Lam</snm>
                  <fnm>CW</fnm>
               </au>
            </aug>
            <source>Genes Immun</source>
            <pubdate>2006</pubdate>
            <volume>7</volume>
            <fpage>59</fpage>
            <lpage>64</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1038/sj.gene.6364279</pubid>
                  <pubid idtype="pmpid" link="fulltext">16435024</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B13">
            <title>
               <p>Genomic variations within DEFB1 are associated with the susceptibility to and the fatal outcome of severe sepsis in Chinese Han population.</p>
            </title>
            <aug>
               <au>
                  <snm>Chen</snm>
                  <fnm>QX</fnm>
               </au>
               <au>
                  <snm>Lv</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Huang</snm>
                  <fnm>LX</fnm>
               </au>
               <au>
                  <snm>Cheng</snm>
                  <fnm>BL</fnm>
               </au>
               <au>
                  <snm>Xie</snm>
                  <fnm>GH</fnm>
               </au>
               <au>
                  <snm>Wu</snm>
                  <fnm>SJ</fnm>
               </au>
               <au>
                  <snm>Fang</snm>
                  <fnm>XM</fnm>
               </au>
            </aug>
            <source>Genes Immun</source>
            <pubdate>2007</pubdate>
            <volume>8</volume>
            <fpage>439</fpage>
            <lpage>443</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1038/sj.gene.6364401</pubid>
                  <pubid idtype="pmpid" link="fulltext">17508030</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B14">
            <title>
               <p>A single-nucleotide polymorphism in the human beta-defensin 1 gene is associated with HIV-1 infection in Italian children.</p>
            </title>
            <aug>
               <au>
                  <snm>Braida</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Boniotto</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Pontillo</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Tovo</snm>
                  <fnm>PA</fnm>
               </au>
               <au>
                  <snm>Amoroso</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Crovella</snm>
                  <fnm>S</fnm>
               </au>
            </aug>
            <source>AIDS</source>
            <pubdate>2004</pubdate>
            <volume>18</volume>
            <fpage>1598</fpage>
            <lpage>1600</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1097/01.aids.0000131363.82951.fb</pubid>
                  <pubid idtype="pmpid" link="fulltext">15238780</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B15">
            <title>
               <p>DEFB1 gene polymorphisms and increased risk of HIV-1 infection in Brazilian children.</p>
            </title>
            <aug>
               <au>
                  <snm>Milanese</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Segat</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Pontillo</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Arraes</snm>
                  <fnm>LC</fnm>
               </au>
               <au>
                  <snm>de Lima Filho</snm>
                  <fnm>JL</fnm>
               </au>
               <au>
                  <snm>Crovella</snm>
                  <fnm>S</fnm>
               </au>
            </aug>
            <source>AIDS</source>
            <pubdate>2006</pubdate>
            <volume>20</volume>
            <fpage>1673</fpage>
            <lpage>1675</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1097/01.aids.0000238417.05819.40</pubid>
                  <pubid idtype="pmpid" link="fulltext">16868452</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B16">
            <title>
               <p>Single-nucleotide polymorphisms (SNPs) in human beta-defensin 1: high-throughput SNP assays and association with Candida carriage in type I diabetics and nondiabetic controls.</p>
            </title>
            <aug>
               <au>
                  <snm>Jurevic</snm>
                  <fnm>RJ</fnm>
               </au>
               <au>
                  <snm>Bai</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Chadwick</snm>
                  <fnm>RB</fnm>
               </au>
               <au>
                  <snm>White</snm>
                  <fnm>TC</fnm>
               </au>
               <au>
                  <snm>Dale</snm>
                  <fnm>BA</fnm>
               </au>
            </aug>
            <source>J Clin Microbiol</source>
            <pubdate>2003</pubdate>
            <volume>41</volume>
            <fpage>90</fpage>
            <lpage>96</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">149626</pubid>
                  <pubid idtype="pmpid" link="fulltext">12517831</pubid>
                  <pubid idtype="doi">10.1128/JCM.41.1.90-96.2003</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B17">
            <title>
               <p>Human beta-defensin-1, a potential chromosome 8p tumor suppressor: control of transcription and induction of apoptosis in renal cell carcinoma.</p>
            </title>
            <aug>
               <au>
                  <snm>Sun</snm>
                  <fnm>CQ</fnm>
               </au>
               <au>
                  <snm>Arnold</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Fernandez-Golarz</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Parrish</snm>
                  <fnm>AB</fnm>
               </au>
               <au>
                  <snm>Almekinder</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>He</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Ho</snm>
                  <fnm>SM</fnm>
               </au>
               <au>
                  <snm>Svoboda</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Pohl</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Marshall</snm>
                  <fnm>FF</fnm>
               </au>
               <au>
                  <snm>Petros</snm>
                  <fnm>JA</fnm>
               </au>
            </aug>
            <source>Cancer Res</source>
            <pubdate>2006</pubdate>
            <volume>66</volume>
            <fpage>8542</fpage>
            <lpage>8549</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1158/0008-5472.CAN-06-0294</pubid>
                  <pubid idtype="pmpid" link="fulltext">16951166</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B18">
            <title>
               <p>The International HapMap Project.</p>
            </title>
            <aug>
               <au>
                  <cnm>The International HapMap Consortium</cnm>
               </au>
            </aug>
            <source>Nature</source>
            <pubdate>2003</pubdate>
            <volume>426</volume>
            <fpage>789</fpage>
            <lpage>796</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1038/nature02168</pubid>
                  <pubid idtype="pmpid" link="fulltext">14685227</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B19">
            <title>
               <p>Innate Immunity in Heart, Lung and Blood Disease: Programs for Genomic Applications</p>
            </title>
            <url>http://innateimmunity.net</url>
         </bibl>
         <bibl id="B20">
            <title>
               <p>A new statistical method for haplotype reconstruction from population data.</p>
            </title>
            <aug>
               <au>
                  <snm>Stephens</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Smith</snm>
                  <fnm>NJ</fnm>
               </au>
               <au>
                  <snm>Donnelly</snm>
                  <fnm>P</fnm>
               </au>
            </aug>
            <source>Am J Hum Genet</source>
            <pubdate>2001</pubdate>
            <volume>68</volume>
            <fpage>978</fpage>
            <lpage>989</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">1275651</pubid>
                  <pubid idtype="pmpid" link="fulltext">11254454</pubid>
                  <pubid idtype="doi">10.1086/319501</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B21">
            <title>
               <p>Accounting for decay of linkage disequilibrium in haplotype inference and missing-data imputation.</p>
            </title>
            <aug>
               <au>
                  <snm>Stephens</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Scheet</snm>
                  <fnm>P</fnm>
               </au>
            </aug>
            <source>Am J Hum Genet</source>
            <pubdate>2005</pubdate>
            <volume>76</volume>
            <fpage>449</fpage>
            <lpage>462</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">1196397</pubid>
                  <pubid idtype="pmpid" link="fulltext">15700229</pubid>
                  <pubid idtype="doi">10.1086/428594</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B22">
            <title>
               <p>On the number of segregating sites in genetical models without recombination.</p>
            </title>
            <aug>
               <au>
                  <snm>Watterson</snm>
                  <fnm>GA</fnm>
               </au>
            </aug>
            <source>Theor Popul Biol</source>
            <pubdate>1975</pubdate>
            <volume>7</volume>
            <fpage>256</fpage>
            <lpage>276</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/0040-5809(75)90020-9</pubid>
                  <pubid idtype="pmpid" link="fulltext">1145509</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B23">
            <title>
               <p>Mathematical model for studying genetic variation in terms of restriction endonucleases.</p>
            </title>
            <aug>
               <au>
                  <snm>Nei</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Li</snm>
                  <fnm>WH</fnm>
               </au>
            </aug>
            <source>Proc Natl Acad Sci USA</source>
            <pubdate>1979</pubdate>
            <volume>76</volume>
            <fpage>5269</fpage>
            <lpage>5273</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">413122</pubid>
                  <pubid idtype="pmpid">291943</pubid>
                  <pubid idtype="doi">10.1073/pnas.76.10.5269</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B24">
            <title>
               <p>Statistical tests for detecting gene conversion.</p>
            </title>
            <aug>
               <au>
                  <snm>Sawyer</snm>
                  <fnm>S</fnm>
               </au>
            </aug>
            <source>Mol Biol Evol</source>
            <pubdate>1989</pubdate>
            <volume>6</volume>
            <fpage>526</fpage>
            <lpage>538</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">2677599</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B25">
            <aug>
               <au>
                  <snm>Kimura</snm>
                  <fnm>M</fnm>
               </au>
            </aug>
            <source>The Neutral Theory of Molecular Evolution</source>
            <publisher>Cambridge: Cambridge University Press</publisher>
            <pubdate>1983</pubdate>
         </bibl>
         <bibl id="B26">
            <title>
               <p>A test of neutral molecular evolution based on nucleotide data.</p>
            </title>
            <aug>
               <au>
                  <snm>Hudson</snm>
                  <fnm>RR</fnm>
               </au>
               <au>
                  <snm>Kreitman</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Aguad&#233;</snm>
                  <fnm>M</fnm>
               </au>
            </aug>
            <source>Genetics</source>
            <pubdate>1987</pubdate>
            <volume>116</volume>
            <fpage>153</fpage>
            <lpage>159</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">1203113</pubid>
                  <pubid idtype="pmpid" link="fulltext">3110004</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B27">
            <title>
               <p>The HKA test revisited: a maximum-likelihood-ratio test of the standard neutral model.</p>
            </title>
            <aug>
               <au>
                  <snm>Wright</snm>
                  <fnm>SI</fnm>
               </au>
               <au>
                  <snm>Charlesworth</snm>
                  <fnm>B</fnm>
               </au>
            </aug>
            <source>Genetics</source>
            <pubdate>2004</pubdate>
            <volume>168</volume>
            <fpage>1071</fpage>
            <lpage>1076</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">1448833</pubid>
                  <pubid idtype="pmpid" link="fulltext">15514076</pubid>
                  <pubid idtype="doi">10.1534/genetics.104.026500</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B28">
            <title>
               <p>The functional genomic distribution of protein divergence in two animal phyla: coevolution, genomic conflict, and constraint.</p>
            </title>
            <aug>
               <au>
                  <snm>Castillo-Davis</snm>
                  <fnm>CI</fnm>
               </au>
               <au>
                  <snm>Kondrashov</snm>
                  <fnm>FA</fnm>
               </au>
               <au>
                  <snm>Hartl</snm>
                  <fnm>DL</fnm>
               </au>
               <au>
                  <snm>Kulathinal</snm>
                  <fnm>RJ</fnm>
               </au>
            </aug>
            <source>Genome Res</source>
            <pubdate>2004</pubdate>
            <volume>14</volume>
            <fpage>802</fpage>
            <lpage>811</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">479106</pubid>
                  <pubid idtype="pmpid" link="fulltext">15123580</pubid>
                  <pubid idtype="doi">10.1101/gr.2195604</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B29">
            <title>
               <p>Analysis of intronic conserved elements indicates that functional complexity might represent a major source of negative selection on non-coding sequences.</p>
            </title>
            <aug>
               <au>
                  <snm>Sironi</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Menozzi</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Comi</snm>
                  <fnm>GP</fnm>
               </au>
               <au>
                  <snm>Cagliani</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Bresolin</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Pozzoli</snm>
                  <fnm>U</fnm>
               </au>
            </aug>
            <source>Hum Mol Genet</source>
            <pubdate>2005</pubdate>
            <volume>14</volume>
            <fpage>2533</fpage>
            <lpage>2546</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1093/hmg/ddi257</pubid>
                  <pubid idtype="pmpid" link="fulltext">16037065</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B30">
            <title>
               <p>The coalescent process in models with selection and recombination.</p>
            </title>
            <aug>
               <au>
                  <snm>Hudson</snm>
                  <fnm>RR</fnm>
               </au>
               <au>
                  <snm>Kaplan</snm>
                  <fnm>NL</fnm>
               </au>
            </aug>
            <source>Genetics</source>
            <pubdate>1988</pubdate>
            <volume>120</volume>
            <fpage>831</fpage>
            <lpage>840</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">1203560</pubid>
                  <pubid idtype="pmpid" link="fulltext">3147214</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B31">
            <title>
               <p>Statistical method for testing the neutral mutation hypothesis by DNA polymorphism.</p>
            </title>
            <aug>
               <au>
                  <snm>Tajima</snm>
                  <fnm>F</fnm>
               </au>
            </aug>
            <source>Genetics</source>
            <pubdate>1989</pubdate>
            <volume>123</volume>
            <fpage>585</fpage>
            <lpage>595</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">1203831</pubid>
                  <pubid idtype="pmpid" link="fulltext">2513255</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B32">
            <title>
               <p>Statistical tests of neutrality of mutations.</p>
            </title>
            <aug>
               <au>
                  <snm>Fu</snm>
                  <fnm>YX</fnm>
               </au>
               <au>
                  <snm>Li</snm>
                  <fnm>WH</fnm>
               </au>
            </aug>
            <source>Genetics</source>
            <pubdate>1993</pubdate>
            <volume>133</volume>
            <fpage>693</fpage>
            <lpage>709</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">1205353</pubid>
                  <pubid idtype="pmpid" link="fulltext">8454210</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B33">
            <title>
               <p>The matrix coalescent and an application to human single-nucleotide polymorphisms.</p>
            </title>
            <aug>
               <au>
                  <snm>Wooding</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Rogers</snm>
                  <fnm>A</fnm>
               </au>
            </aug>
            <source>Genetics</source>
            <pubdate>2002</pubdate>
            <volume>161</volume>
            <fpage>1641</fpage>
            <lpage>1650</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">1462217</pubid>
                  <pubid idtype="pmpid" link="fulltext">12196407</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B34">
            <title>
               <p>The allele frequency spectrum in genome-wide human variation data reveals signals of differential demographic history in three large world populations.</p>
            </title>
            <aug>
               <au>
                  <snm>Marth</snm>
                  <fnm>GT</fnm>
               </au>
               <au>
                  <snm>Czabarka</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Murvai</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Sherry</snm>
                  <fnm>ST</fnm>
               </au>
            </aug>
            <source>Genetics</source>
            <pubdate>2004</pubdate>
            <volume>166</volume>
            <fpage>351</fpage>
            <lpage>372</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">1470693</pubid>
                  <pubid idtype="pmpid" link="fulltext">15020430</pubid>
                  <pubid idtype="doi">10.1534/genetics.166.1.351</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B35">
            <title>
               <p>National Institute of Environmental Health Sciences</p>
            </title>
            <url>http://egp.gs.washington.edu</url>
         </bibl>
         <bibl id="B36">
            <title>
               <p>CYP3A variation and the evolution of salt-sensitivity variants.</p>
            </title>
            <aug>
               <au>
                  <snm>Thompson</snm>
                  <fnm>EE</fnm>
               </au>
               <au>
                  <snm>Kuttab-Boulos</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Witonsky</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Yang</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Roe</snm>
                  <fnm>BA</fnm>
               </au>
               <au>
                  <snm>Di Rienzo</snm>
                  <fnm>A</fnm>
               </au>
            </aug>
            <source>Am J Hum Genet</source>
            <pubdate>2004</pubdate>
            <volume>75</volume>
            <fpage>1059</fpage>
            <lpage>1069</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">1182141</pubid>
                  <pubid idtype="pmpid" link="fulltext">15492926</pubid>
                  <pubid idtype="doi">10.1086/426406</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B37">
            <title>
               <p>Calibrating a coalescent simulation of human genome sequence variation.</p>
            </title>
            <aug>
               <au>
                  <snm>Schaffner</snm>
                  <fnm>SF</fnm>
               </au>
               <au>
                  <snm>Foo</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Gabriel</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Reich</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Daly</snm>
                  <fnm>MJ</fnm>
               </au>
               <au>
                  <snm>Altshuler</snm>
                  <fnm>D</fnm>
               </au>
            </aug>
            <source>Genome Res</source>
            <pubdate>2005</pubdate>
            <volume>15</volume>
            <fpage>1576</fpage>
            <lpage>1583</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">1310645</pubid>
                  <pubid idtype="pmpid" link="fulltext">16251467</pubid>
                  <pubid idtype="doi">10.1101/gr.3709305</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B38">
            <title>
               <p>Genetical structure of populations.</p>
            </title>
            <aug>
               <au>
                  <snm>Wright</snm>
                  <fnm>S</fnm>
               </au>
            </aug>
            <source>Nature</source>
            <pubdate>1950</pubdate>
            <volume>166</volume>
            <fpage>247</fpage>
            <lpage>249</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1038/166247a0</pubid>
                  <pubid idtype="pmpid">15439261</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B39">
            <title>
               <p>Drift, admixture, and selection in human evolution: a study with DNA polymorphisms.</p>
            </title>
            <aug>
               <au>
                  <snm>Bowcock</snm>
                  <fnm>AM</fnm>
               </au>
               <au>
                  <snm>Kidd</snm>
                  <fnm>JR</fnm>
               </au>
               <au>
                  <snm>Mountain</snm>
                  <fnm>JL</fnm>
               </au>
               <au>
                  <snm>Hebert</snm>
                  <fnm>JM</fnm>
               </au>
               <au>
                  <snm>Carotenuto</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Kidd</snm>
                  <fnm>KK</fnm>
               </au>
               <au>
                  <snm>Cavalli-Sforza</snm>
                  <fnm>LL</fnm>
               </au>
            </aug>
            <source>Proc Natl Acad Sci USA</source>
            <pubdate>1991</pubdate>
            <volume>88</volume>
            <fpage>839</fpage>
            <lpage>843</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">50909</pubid>
                  <pubid idtype="pmpid" link="fulltext">1992475</pubid>
                  <pubid idtype="doi">10.1073/pnas.88.3.839</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B40">
            <title>
               <p>Interrogating a high-density SNP map for signatures of natural selection.</p>
            </title>
            <aug>
               <au>
                  <snm>Akey</snm>
                  <fnm>JM</fnm>
               </au>
               <au>
                  <snm>Zhang</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Zhang</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Jin</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Shriver</snm>
                  <fnm>MD</fnm>
               </au>
            </aug>
            <source>Genome Res</source>
            <pubdate>2002</pubdate>
            <volume>12</volume>
            <fpage>1805</fpage>
            <lpage>1814</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">187574</pubid>
                  <pubid idtype="pmpid" link="fulltext">12466284</pubid>
                  <pubid idtype="doi">10.1101/gr.631202</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B41">
            <title>
               <p>Extensive normal copy number variation of a beta-defensin antimicrobial-gene cluster.</p>
            </title>
            <aug>
               <au>
                  <snm>Hollox</snm>
                  <fnm>EJ</fnm>
               </au>
               <au>
                  <snm>Armour</snm>
                  <fnm>JA</fnm>
               </au>
               <au>
                  <snm>Barber</snm>
                  <fnm>JC</fnm>
               </au>
            </aug>
            <source>Am J Hum Genet</source>
            <pubdate>2003</pubdate>
            <volume>73</volume>
            <fpage>591</fpage>
            <lpage>600</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">1180683</pubid>
                  <pubid idtype="pmpid" link="fulltext">12916016</pubid>
                  <pubid idtype="doi">10.1086/378157</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B42">
            <title>
               <p>Global variation in copy number in the human genome.</p>
            </title>
            <aug>
               <au>
                  <snm>Redon</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Ishikawa</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Fitch</snm>
                  <fnm>KR</fnm>
               </au>
               <au>
                  <snm>Feuk</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Perry</snm>
                  <fnm>GH</fnm>
               </au>
               <au>
                  <snm>Andrews</snm>
                  <fnm>TD</fnm>
               </au>
               <au>
                  <snm>Fiegler</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Shapero</snm>
                  <fnm>MH</fnm>
               </au>
               <au>
                  <snm>Carson</snm>
                  <fnm>AR</fnm>
               </au>
               <au>
                  <snm>Chen</snm>
                  <fnm>W</fnm>
               </au>
               <au>
                  <snm>Cho</snm>
                  <fnm>EK</fnm>
               </au>
               <au>
                  <snm>Dallaire</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Freeman</snm>
                  <fnm>JL</fnm>
               </au>
               <au>
                  <snm>Gonzalez</snm>
                  <fnm>JR</fnm>
               </au>
               <au>
                  <snm>Gratacos</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Huang</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Kalaitzopoulos</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Komura</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>MacDonald</snm>
                  <fnm>JR</fnm>
               </au>
               <au>
                  <snm>Marshall</snm>
                  <fnm>CR</fnm>
               </au>
               <au>
                  <snm>Mei</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Montgomery</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Nishimura</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Okamura</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Shen</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Somerville</snm>
                  <fnm>MJ</fnm>
               </au>
               <au>
                  <snm>Tchinda</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Valsesia</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Woodwark</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Yang</snm>
                  <fnm>F</fnm>
               </au>
               <etal/>
            </aug>
            <source>Nature</source>
            <pubdate>2006</pubdate>
            <volume>444</volume>
            <fpage>444</fpage>
            <lpage>454</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1038/nature05329</pubid>
                  <pubid idtype="pmpid" link="fulltext">17122850</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B43">
            <title>
               <p>Copy number polymorphisms are not a common feature of innate immune genes.</p>
            </title>
            <aug>
               <au>
                  <snm>Linzmeier</snm>
                  <fnm>RM</fnm>
               </au>
               <au>
                  <snm>Ganz</snm>
                  <fnm>T</fnm>
               </au>
            </aug>
            <source>Genomics</source>
            <pubdate>2006</pubdate>
            <volume>88</volume>
            <fpage>122</fpage>
            <lpage>126</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/j.ygeno.2006.03.005</pubid>
                  <pubid idtype="pmpid" link="fulltext">16617005</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B44">
            <title>
               <p>Median-joining networks for inferring intraspecific phylogenies.</p>
            </title>
            <aug>
               <au>
                  <snm>Bandelt</snm>
                  <fnm>HJ</fnm>
               </au>
               <au>
                  <snm>Forster</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>R&#246;hl</snm>
                  <fnm>A</fnm>
               </au>
            </aug>
            <source>Mol Biol Evol</source>
            <pubdate>1999</pubdate>
            <volume>16</volume>
            <fpage>37</fpage>
            <lpage>48</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid" link="fulltext">10331250</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B45">
            <title>
               <p>Allelic genealogy and human evolution.</p>
            </title>
            <aug>
               <au>
                  <snm>Takahata</snm>
                  <fnm>N</fnm>
               </au>
            </aug>
            <source>Mol Biol Evol</source>
            <pubdate>1993</pubdate>
            <volume>10</volume>
            <fpage>2</fpage>
            <lpage>22</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">8450756</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B46">
            <title>
               <p>Neutral behavior of shared polymorphism.</p>
            </title>
            <aug>
               <au>
                  <snm>Clark</snm>
                  <fnm>AG</fnm>
               </au>
            </aug>
            <source>Proc Natl Acad Sci USA</source>
            <pubdate>1997</pubdate>
            <volume>94</volume>
            <fpage>7730</fpage>
            <lpage>7734</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">33687</pubid>
                  <pubid idtype="pmpid" link="fulltext">9223256</pubid>
                  <pubid idtype="doi">10.1073/pnas.94.15.7730</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B47">
            <title>
               <p>A limited role for balancing selection.</p>
            </title>
            <aug>
               <au>
                  <snm>Asthana</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Schmidt</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Sunyaev</snm>
                  <fnm>S</fnm>
               </au>
            </aug>
            <source>Trends Genet</source>
            <pubdate>2005</pubdate>
            <volume>21</volume>
            <fpage>30</fpage>
            <lpage>32</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/j.tig.2004.11.001</pubid>
                  <pubid idtype="pmpid" link="fulltext">15680511</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B48">
            <aug>
               <au>
                  <snm>Haldane</snm>
                  <fnm>JBS</fnm>
               </au>
            </aug>
            <source>The Causes of Evolution</source>
            <publisher>New York: Harper &amp; Row</publisher>
            <pubdate>1932</pubdate>
         </bibl>
         <bibl id="B49">
            <title>
               <p>Evolution of vertebrate immunoglobulin variable gene segments.</p>
            </title>
            <aug>
               <au>
                  <snm>Ota</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Sitnikova</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Nei</snm>
                  <fnm>M</fnm>
               </au>
            </aug>
            <source>Curr Top Microbiol Immunol</source>
            <pubdate>2000</pubdate>
            <volume>248</volume>
            <fpage>221</fpage>
            <lpage>245</lpage>
            <xrefbib>
               <pubid idtype="pmpid">10793480</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B50">
            <title>
               <p>Natural selection at major histocompatibility complex loci of vertebrates.</p>
            </title>
            <aug>
               <au>
                  <snm>Hughes</snm>
                  <fnm>AL</fnm>
               </au>
               <au>
                  <snm>Yeager</snm>
                  <fnm>M</fnm>
               </au>
            </aug>
            <source>Annu Rev Genet</source>
            <pubdate>1998</pubdate>
            <volume>32</volume>
            <fpage>415</fpage>
            <lpage>435</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1146/annurev.genet.32.1.415</pubid>
                  <pubid idtype="pmpid" link="fulltext">9928486</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B51">
            <title>
               <p>Coordinated amino acid changes in the evolution of mammalian defensins.</p>
            </title>
            <aug>
               <au>
                  <snm>Hughes</snm>
                  <fnm>AL</fnm>
               </au>
               <au>
                  <snm>Yeager</snm>
                  <fnm>M</fnm>
               </au>
            </aug>
            <source>J Mol Evol</source>
            <pubdate>1997</pubdate>
            <volume>44</volume>
            <fpage>675</fpage>
            <lpage>682</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1007/PL00006191</pubid>
                  <pubid idtype="pmpid" link="fulltext">9169560</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B52">
            <title>
               <p>Human beta-defensin-1 is a salt-sensitive antibiotic in lung that is inactivated in cystic fibrosis.</p>
            </title>
            <aug>
               <au>
                  <snm>Goldman</snm>
                  <fnm>MJ</fnm>
               </au>
               <au>
                  <snm>Anderson</snm>
                  <fnm>GM</fnm>
               </au>
               <au>
                  <snm>Stolzenberg</snm>
                  <fnm>ED</fnm>
               </au>
               <au>
                  <snm>Kari</snm>
                  <fnm>UP</fnm>
               </au>
               <au>
                  <snm>Zasloff</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Wilson</snm>
                  <fnm>JM</fnm>
               </au>
            </aug>
            <source>Cell</source>
            <pubdate>1997</pubdate>
            <volume>88</volume>
            <fpage>553</fpage>
            <lpage>560</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/S0092-8674(00)81895-4</pubid>
                  <pubid idtype="pmpid" link="fulltext">9038346</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B53">
            <title>
               <p>Differential expression of alpha- and beta-defensins in human peripheral blood.</p>
            </title>
            <aug>
               <au>
                  <snm>Fang</snm>
                  <fnm>XM</fnm>
               </au>
               <au>
                  <snm>Shu</snm>
                  <fnm>Q</fnm>
               </au>
               <au>
                  <snm>Chen</snm>
                  <fnm>QX</fnm>
               </au>
               <au>
                  <snm>Book</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Sahl</snm>
                  <fnm>HG</fnm>
               </au>
               <au>
                  <snm>Hoeft</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Stuber</snm>
                  <fnm>F</fnm>
               </au>
            </aug>
            <source>Eur J Clin Invest</source>
            <pubdate>2003</pubdate>
            <volume>33</volume>
            <fpage>82</fpage>
            <lpage>87</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1046/j.1365-2362.2003.01076.x</pubid>
                  <pubid idtype="pmpid" link="fulltext">12492457</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B54">
            <title>
               <p>Production of beta-defensins by human airway epithelia.</p>
            </title>
            <aug>
               <au>
                  <snm>Singh</snm>
                  <fnm>PK</fnm>
               </au>
               <au>
                  <snm>Jia</snm>
                  <fnm>HP</fnm>
               </au>
               <au>
                  <snm>Wiles</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Hesselberth</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Liu</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Conway</snm>
                  <fnm>BA</fnm>
               </au>
               <au>
                  <snm>Greenberg</snm>
                  <fnm>EP</fnm>
               </au>
               <au>
                  <snm>Valore</snm>
                  <fnm>EV</fnm>
               </au>
               <au>
                  <snm>Welsh</snm>
                  <fnm>MJ</fnm>
               </au>
               <au>
                  <snm>Ganz</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Tack</snm>
                  <fnm>BF</fnm>
               </au>
               <au>
                  <snm>McCray</snm>
                  <fnm>PB</fnm>
                  <suf>Jr</suf>
               </au>
            </aug>
            <source>Proc Natl Acad Sci USA</source>
            <pubdate>1998</pubdate>
            <volume>95</volume>
            <fpage>14961</fpage>
            <lpage>14966</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">24558</pubid>
                  <pubid idtype="pmpid" link="fulltext">9843998</pubid>
                  <pubid idtype="doi">10.1073/pnas.95.25.14961</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B55">
            <title>
               <p>Widespread expression of beta-defensin hBD-1 in human secretory glands and epithelial cells.</p>
            </title>
            <aug>
               <au>
                  <snm>Zhao</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Wang</snm>
                  <fnm>I</fnm>
               </au>
               <au>
                  <snm>Lehrer</snm>
                  <fnm>RI</fnm>
               </au>
            </aug>
            <source>FEBS Lett</source>
            <pubdate>1996</pubdate>
            <volume>396</volume>
            <fpage>319</fpage>
            <lpage>322</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/0014-5793(96)01123-4</pubid>
                  <pubid idtype="pmpid" link="fulltext">8915011</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B56">
            <title>
               <p>Human beta-defensin-1: an antimicrobial peptide of urogenital tissues.</p>
            </title>
            <aug>
               <au>
                  <snm>Valore</snm>
                  <fnm>EV</fnm>
               </au>
               <au>
                  <snm>Park</snm>
                  <fnm>CH</fnm>
               </au>
               <au>
                  <snm>Quayle</snm>
                  <fnm>AJ</fnm>
               </au>
               <au>
                  <snm>Wiles</snm>
                  <fnm>KR</fnm>
               </au>
               <au>
                  <snm>McCray</snm>
                  <fnm>PB</fnm>
                  <suf>Jr</suf>
               </au>
               <au>
                  <snm>Ganz</snm>
                  <fnm>T</fnm>
               </au>
            </aug>
            <source>J Clin Invest</source>
            <pubdate>1998</pubdate>
            <volume>101</volume>
            <fpage>1633</fpage>
            <lpage>1642</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">508744</pubid>
                  <pubid idtype="pmpid" link="fulltext">9541493</pubid>
                  <pubid idtype="doi">10.1172/JCI1861</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B57">
            <title>
               <p>beta-Defensin 1 contributes to pulmonary innate immunity in mice.</p>
            </title>
            <aug>
               <au>
                  <snm>Moser</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Weiner</snm>
                  <fnm>DJ</fnm>
               </au>
               <au>
                  <snm>Lysenko</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Bals</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Weiser</snm>
                  <fnm>JN</fnm>
               </au>
               <au>
                  <snm>Wilson</snm>
                  <fnm>JM</fnm>
               </au>
            </aug>
            <source>Infect Immun</source>
            <pubdate>2002</pubdate>
            <volume>70</volume>
            <fpage>3068</fpage>
            <lpage>3072</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">127957</pubid>
                  <pubid idtype="pmpid" link="fulltext">12010999</pubid>
                  <pubid idtype="doi">10.1128/IAI.70.6.3068-3072.2002</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B58">
            <title>
               <p>Characterization of the mouse beta defensin 1, Defb1, mutant mouse model.</p>
            </title>
            <aug>
               <au>
                  <snm>Morrison</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Kilanowski</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Davidson</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Dorin</snm>
                  <fnm>J</fnm>
               </au>
            </aug>
            <source>Infect Immun</source>
            <pubdate>2002</pubdate>
            <volume>70</volume>
            <fpage>3053</fpage>
            <lpage>3060</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">128030</pubid>
                  <pubid idtype="pmpid" link="fulltext">12010997</pubid>
                  <pubid idtype="doi">10.1128/IAI.70.6.3053-3060.2002</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B59">
            <title>
               <p>Expression of the peptide antibiotic human beta-defensin 1 in cultured gingival epithelial cells and gingival tissue.</p>
            </title>
            <aug>
               <au>
                  <snm>Krisanaprakornkit</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Weinberg</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Perez</snm>
                  <fnm>CN</fnm>
               </au>
               <au>
                  <snm>Dale</snm>
                  <fnm>BA</fnm>
               </au>
            </aug>
            <source>Infect Immun</source>
            <pubdate>1998</pubdate>
            <volume>66</volume>
            <fpage>4222</fpage>
            <lpage>4228</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">108509</pubid>
                  <pubid idtype="pmpid" link="fulltext">9712771</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B60">
            <title>
               <p>Expression of the peptide antibiotics human beta defensin-1 and human beta defensin-2 in normal human skin.</p>
            </title>
            <aug>
               <au>
                  <snm>Ali</snm>
                  <fnm>RS</fnm>
               </au>
               <au>
                  <snm>Falconer</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Ikram</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Bissett</snm>
                  <fnm>CE</fnm>
               </au>
               <au>
                  <snm>Cerio</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Quinn</snm>
                  <fnm>AG</fnm>
               </au>
            </aug>
            <source>J Invest Dermatol</source>
            <pubdate>2001</pubdate>
            <volume>117</volume>
            <fpage>106</fpage>
            <lpage>111</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1046/j.0022-202x.2001.01401.x</pubid>
                  <pubid idtype="pmpid" link="fulltext">11442756</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B61">
            <title>
               <p>Production of beta-defensin antimicrobial peptides by the oral mucosa and salivary glands.</p>
            </title>
            <aug>
               <au>
                  <snm>Mathews</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Jia</snm>
                  <fnm>HP</fnm>
               </au>
               <au>
                  <snm>Guthmiller</snm>
                  <fnm>JM</fnm>
               </au>
               <au>
                  <snm>Losh</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Graham</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Johnson</snm>
                  <fnm>GK</fnm>
               </au>
               <au>
                  <snm>Tack</snm>
                  <fnm>BF</fnm>
               </au>
               <au>
                  <snm>McCray</snm>
                  <fnm>PB</fnm>
                  <suf>Jr</suf>
               </au>
            </aug>
            <source>Infect Immun</source>
            <pubdate>1999</pubdate>
            <volume>67</volume>
            <fpage>2740</fpage>
            <lpage>2745</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">96577</pubid>
                  <pubid idtype="pmpid" link="fulltext">10338476</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B62">
            <title>
               <p>Abundant human beta-defensin-1 expression in milk and mammary gland epithelium.</p>
            </title>
            <aug>
               <au>
                  <snm>Jia</snm>
                  <fnm>HP</fnm>
               </au>
               <au>
                  <snm>Starner</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Ackermann</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Kirby</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Tack</snm>
                  <fnm>BF</fnm>
               </au>
               <au>
                  <snm>McCray</snm>
                  <fnm>PB</fnm>
                  <suf>Jr</suf>
               </au>
            </aug>
            <source>J Pediatr</source>
            <pubdate>2001</pubdate>
            <volume>138</volume>
            <fpage>109</fpage>
            <lpage>112</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1067/mpd.2001.109375</pubid>
                  <pubid idtype="pmpid" link="fulltext">11148522</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B63">
            <title>
               <p>Beta-defensin expression in human mammary gland epithelia.</p>
            </title>
            <aug>
               <au>
                  <snm>Tunzi</snm>
                  <fnm>CR</fnm>
               </au>
               <au>
                  <snm>Harper</snm>
                  <fnm>PA</fnm>
               </au>
               <au>
                  <snm>Bar-Oz</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Valore</snm>
                  <fnm>EV</fnm>
               </au>
               <au>
                  <snm>Semple</snm>
                  <fnm>JL</fnm>
               </au>
               <au>
                  <snm>Watson-MacDonell</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Ganz</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Ito</snm>
                  <fnm>S</fnm>
               </au>
            </aug>
            <source>Pediatr Res</source>
            <pubdate>2000</pubdate>
            <volume>48</volume>
            <fpage>30</fpage>
            <lpage>35</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1203/00006450-200007000-00008</pubid>
                  <pubid idtype="pmpid" link="fulltext">10879797</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B64">
            <title>
               <p>Transcriptional effect of DEFB1 gene 5' untranslated region polymorphisms.</p>
            </title>
            <aug>
               <au>
                  <snm>Milanese</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Segat</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Crovella</snm>
                  <fnm>S</fnm>
               </au>
            </aug>
            <source>Cancer Res</source>
            <pubdate>2007</pubdate>
            <volume>67</volume>
            <fpage>5997</fpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1158/0008-5472.CAN-06-3544</pubid>
                  <pubid idtype="pmpid" link="fulltext">17575171</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B65">
            <title>
               <p>Transcriptional effect of DEFB1 gene 5' untranslated region polymorphisms.</p>
            </title>
            <aug>
               <au>
                  <snm>Petros</snm>
                  <fnm>J</fnm>
               </au>
            </aug>
            <source>Cancer Res</source>
            <pubdate>2007</pubdate>
            <volume>67</volume>
            <fpage>5997</fpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1158/0008-5472.CAN-07-0204</pubid>
                  <pubid idtype="pmpid" link="fulltext">17575171</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B66">
            <title>
               <p>Association of beta-defensin-1 gene polymorphisms with <it>Pseudomonas aeruginosa </it>airway colonization in cystic fibrosis.</p>
            </title>
            <aug>
               <au>
                  <snm>Tesse</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Cardinale</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Santostasi</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Polizzi</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Manca</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Mappa</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Iacoviello</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>De Robertis</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Logrillo</snm>
                  <fnm>VP</fnm>
               </au>
               <au>
                  <snm>Armenio</snm>
                  <fnm>L</fnm>
               </au>
            </aug>
            <source>Genes Immun</source>
            <pubdate>2008</pubdate>
            <volume>9</volume>
            <fpage>57</fpage>
            <lpage>60</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1038/sj.gene.6364440</pubid>
                  <pubid idtype="pmpid" link="fulltext">17960157</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B67">
            <title>
               <p>Scope and epidemiology of pediatric sepsis.</p>
            </title>
            <aug>
               <au>
                  <snm>Watson</snm>
                  <fnm>RS</fnm>
               </au>
               <au>
                  <snm>Carcillo</snm>
                  <fnm>JA</fnm>
               </au>
            </aug>
            <source>Pediatr Crit Care Med</source>
            <pubdate>2005</pubdate>
            <volume>6</volume>
            <issue>3 Suppl</issue>
            <fpage>S3</fpage>
            <lpage>S5</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1097/01.PCC.0000161289.22464.C3</pubid>
                  <pubid idtype="pmpid" link="fulltext">15857554</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B68">
            <title>
               <p>Spread of an inactive form of caspase-12 in humans is due to recent positive selection.</p>
            </title>
            <aug>
               <au>
                  <snm>Xue</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Daly</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Yngvadottir</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Liu</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Coop</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Kim</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Sabeti</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Chen</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Stalker</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Huckle</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Burton</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Leonard</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Rogers</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Tyler-Smith</snm>
                  <fnm>C</fnm>
               </au>
            </aug>
            <source>Am J Hum Genet</source>
            <pubdate>2006</pubdate>
            <volume>78</volume>
            <fpage>659</fpage>
            <lpage>670</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">1424700</pubid>
                  <pubid idtype="pmpid" link="fulltext">16532395</pubid>
                  <pubid idtype="doi">10.1086/503116</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B69">
            <title>
               <p>People and disease.</p>
            </title>
            <aug>
               <au>
                  <snm>Dobson</snm>
                  <fnm>A</fnm>
               </au>
            </aug>
            <source>The Cambridge Encyclopedia of Human Evolution</source>
            <publisher>Cambridge: Cambridge University Press</publisher>
            <editor>Jones S, Martin R, Pilbeam D</editor>
            <pubdate>1992</pubdate>
            <fpage>411</fpage>
            <lpage>420</lpage>
         </bibl>
         <bibl id="B70">
            <title>
               <p>Balancing selection and its effects on sequences in nearby genome regions.</p>
            </title>
            <aug>
               <au>
                  <snm>Charlesworth</snm>
                  <fnm>D</fnm>
               </au>
            </aug>
            <source>PLoS Genet</source>
            <pubdate>2006</pubdate>
            <volume>2</volume>
            <fpage>e64</fpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">1449905</pubid>
                  <pubid idtype="pmpid" link="fulltext">16683038</pubid>
                  <pubid idtype="doi">10.1371/journal.pgen.0020064</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B71">
            <title>
               <p>When did the human population size start increasing?</p>
            </title>
            <aug>
               <au>
                  <snm>Wall</snm>
                  <fnm>JD</fnm>
               </au>
               <au>
                  <snm>Przeworski</snm>
                  <fnm>M</fnm>
               </au>
            </aug>
            <source>Genetics</source>
            <pubdate>2000</pubdate>
            <volume>155</volume>
            <fpage>1865</fpage>
            <lpage>1874</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">1461207</pubid>
                  <pubid idtype="pmpid" link="fulltext">10924481</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B72">
            <title>
               <p>Population growth makes waves in the distribution of pairwise genetic differences.</p>
            </title>
            <aug>
               <au>
                  <snm>Rogers</snm>
                  <fnm>AR</fnm>
               </au>
               <au>
                  <snm>Harpending</snm>
                  <fnm>H</fnm>
               </au>
            </aug>
            <source>Mol Biol Evol</source>
            <pubdate>1992</pubdate>
            <volume>9</volume>
            <fpage>552</fpage>
            <lpage>569</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">1316531</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B73">
            <title>
               <p>Genetic evidence for a Paleolithic human population expansion in Africa.</p>
            </title>
            <aug>
               <au>
                  <snm>Reich</snm>
                  <fnm>DE</fnm>
               </au>
               <au>
                  <snm>Goldstein</snm>
                  <fnm>DB</fnm>
               </au>
            </aug>
            <source>Proc Natl Acad Sci USA</source>
            <pubdate>1998</pubdate>
            <volume>95</volume>
            <fpage>8119</fpage>
            <lpage>8123</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">20939</pubid>
                  <pubid idtype="pmpid" link="fulltext">9653150</pubid>
                  <pubid idtype="doi">10.1073/pnas.95.14.8119</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B74">
            <title>
               <p>Ancient origin and gene mosaicism of the progenitor of <it>Mycobacterium tuberculosis</it>.</p>
            </title>
            <aug>
               <au>
                  <snm>Gutierrez</snm>
                  <fnm>MC</fnm>
               </au>
               <au>
                  <snm>Brisse</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Brosch</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Fabre</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Omais</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Marmiesse</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Supply</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Vincent</snm>
                  <fnm>V</fnm>
               </au>
            </aug>
            <source>PLoS Pathog</source>
            <pubdate>2005</pubdate>
            <volume>1</volume>
            <fpage>e5</fpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">1238740</pubid>
                  <pubid idtype="pmpid" link="fulltext">16201017</pubid>
                  <pubid idtype="doi">10.1371/journal.ppat.0010005</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B75">
            <title>
               <p>A re-evaluation of <it>M. prototuberculosis</it>.</p>
            </title>
            <aug>
               <au>
                  <snm>Smith</snm>
                  <fnm>NH</fnm>
               </au>
            </aug>
            <source>PLoS Pathog</source>
            <pubdate>2006</pubdate>
            <volume>2</volume>
            <fpage>e98</fpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">1579242</pubid>
                  <pubid idtype="pmpid" link="fulltext">17009867</pubid>
                  <pubid idtype="doi">10.1371/journal.ppat.0020098</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B76">
            <title>
               <p>The distribution of variation in regulatory gene segments, as present in MHC class II promoters.</p>
            </title>
            <aug>
               <au>
                  <snm>Cowell</snm>
                  <fnm>LG</fnm>
               </au>
               <au>
                  <snm>Kepler</snm>
                  <fnm>TB</fnm>
               </au>
               <au>
                  <snm>Janitz</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Lauster</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Mitchison</snm>
                  <fnm>NA</fnm>
               </au>
            </aug>
            <source>Genome Res</source>
            <pubdate>1998</pubdate>
            <volume>8</volume>
            <fpage>124</fpage>
            <lpage>134</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">9477340</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B77">
            <title>
               <p>Allelic variation in transcription modulates MHC class II expression and function.</p>
            </title>
            <aug>
               <au>
                  <snm>Beaty</snm>
                  <fnm>JS</fnm>
               </au>
               <au>
                  <snm>Sukiennicki</snm>
                  <fnm>TL</fnm>
               </au>
               <au>
                  <snm>Nepom</snm>
                  <fnm>GT</fnm>
               </au>
            </aug>
            <source>Microbes Infect</source>
            <pubdate>1999</pubdate>
            <volume>1</volume>
            <fpage>919</fpage>
            <lpage>927</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/S1286-4579(99)00225-7</pubid>
                  <pubid idtype="pmpid" link="fulltext">10614010</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B78">
            <title>
               <p>Functional effects of a natural polymorphism in the transcriptional regulatory sequence of HLA-DQB1.</p>
            </title>
            <aug>
               <au>
                  <snm>Beaty</snm>
                  <fnm>JS</fnm>
               </au>
               <au>
                  <snm>West</snm>
                  <fnm>KA</fnm>
               </au>
               <au>
                  <snm>Nepom</snm>
                  <fnm>GT</fnm>
               </au>
            </aug>
            <source>Mol Cell Biol</source>
            <pubdate>1995</pubdate>
            <volume>15</volume>
            <fpage>4771</fpage>
            <lpage>4782</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">230721</pubid>
                  <pubid idtype="pmpid" link="fulltext">7651394</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B79">
            <title>
               <p>Innate immunity in the human female reproductive tract: antiviral response of uterine epithelial cells to the TLR3 agonist poly(I:C).</p>
            </title>
            <aug>
               <au>
                  <snm>Schaefer</snm>
                  <fnm>TM</fnm>
               </au>
               <au>
                  <snm>Fahey</snm>
                  <fnm>JV</fnm>
               </au>
               <au>
                  <snm>Wright</snm>
                  <fnm>JA</fnm>
               </au>
               <au>
                  <snm>Wira</snm>
                  <fnm>CR</fnm>
               </au>
            </aug>
            <source>J Immunol</source>
            <pubdate>2005</pubdate>
            <volume>174</volume>
            <fpage>992</fpage>
            <lpage>1002</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">15634923</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B80">
            <title>
               <p>Race-specific HIV-1 disease-modifying effects associated with CCR5 haplotypes.</p>
            </title>
            <aug>
               <au>
                  <snm>Gonzalez</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Bamshad</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Sato</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Mummidi</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Dhanda</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Catano</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Cabrera</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>McBride</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Cao</snm>
                  <fnm>XH</fnm>
               </au>
               <au>
                  <snm>Merrill</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>O'Connell</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Bowden</snm>
                  <fnm>DW</fnm>
               </au>
               <au>
                  <snm>Freedman</snm>
                  <fnm>BI</fnm>
               </au>
               <au>
                  <snm>Anderson</snm>
                  <fnm>SA</fnm>
               </au>
               <au>
                  <snm>Walter</snm>
                  <fnm>EA</fnm>
               </au>
               <au>
                  <snm>Evans</snm>
                  <fnm>JS</fnm>
               </au>
               <au>
                  <snm>Stephan</snm>
                  <fnm>KT</fnm>
               </au>
               <au>
                  <snm>Clark</snm>
                  <fnm>RA</fnm>
               </au>
               <au>
                  <snm>Tyagi</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Ahuja</snm>
                  <fnm>SS</fnm>
               </au>
               <au>
                  <snm>Dolan</snm>
                  <fnm>MJ</fnm>
               </au>
               <au>
                  <snm>Ahuja</snm>
                  <fnm>SK</fnm>
               </au>
            </aug>
            <source>Proc Natl Acad Sci USA</source>
            <pubdate>1999</pubdate>
            <volume>96</volume>
            <fpage>12004</fpage>
            <lpage>12009</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">18402</pubid>
                  <pubid idtype="pmpid" link="fulltext">10518566</pubid>
                  <pubid idtype="doi">10.1073/pnas.96.21.12004</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B81">
            <title>
               <p>A review of the genetic epidemiology of resistance to parasitic disease and atopic asthma: common variants for common phenotypes?</p>
            </title>
            <aug>
               <au>
                  <snm>Barnes</snm>
                  <fnm>KC</fnm>
               </au>
               <au>
                  <snm>Grant</snm>
                  <fnm>AV</fnm>
               </au>
               <au>
                  <snm>Gao</snm>
                  <fnm>P</fnm>
               </au>
            </aug>
            <source>Curr Opin Allergy Clin Immunol</source>
            <pubdate>2005</pubdate>
            <volume>5</volume>
            <fpage>379</fpage>
            <lpage>385</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">16131910</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B82">
            <title>
               <p>A population genetics study of single nucleotide polymorphisms in the interleukin 4 receptor alpha (IL4RA) gene.</p>
            </title>
            <aug>
               <au>
                  <snm>Wu</snm>
                  <fnm>X</fnm>
               </au>
               <au>
                  <snm>Di Rienzo</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Ober</snm>
                  <fnm>C</fnm>
               </au>
            </aug>
            <source>Genes Immun</source>
            <pubdate>2001</pubdate>
            <volume>2</volume>
            <fpage>128</fpage>
            <lpage>134</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1038/sj.gene.6363746</pubid>
                  <pubid idtype="pmpid" link="fulltext">11426321</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B83">
            <title>
               <p>UCSC Genome Browser</p>
            </title>
            <url>http://genome.ucsc.edu</url>
         </bibl>
         <bibl id="B84">
            <title>
               <p>Libsequence: a C++ class library for evolutionary genetic analysis.</p>
            </title>
            <aug>
               <au>
                  <snm>Thornton</snm>
                  <fnm>K</fnm>
               </au>
            </aug>
            <source>Bioinformatics</source>
            <pubdate>2003</pubdate>
            <volume>19</volume>
            <fpage>2325</fpage>
            <lpage>2327</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1093/bioinformatics/btg316</pubid>
                  <pubid idtype="pmpid" link="fulltext">14630667</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B85">
            <title>
               <p>Generating samples under a Wright-Fisher neutral model of genetic variation.</p>
            </title>
            <aug>
               <au>
                  <snm>Hudson</snm>
                  <fnm>RR</fnm>
               </au>
            </aug>
            <source>Bioinformatics</source>
            <pubdate>2002</pubdate>
            <volume>18</volume>
            <fpage>337</fpage>
            <lpage>338</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1093/bioinformatics/18.2.337</pubid>
                  <pubid idtype="pmpid" link="fulltext">11847089</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B86">
            <title>
               <p>Estimation of levels of gene flow from DNA sequence data.</p>
            </title>
            <aug>
               <au>
                  <snm>Hudson</snm>
                  <fnm>RR</fnm>
               </au>
               <au>
                  <snm>Slatkin</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Maddison</snm>
                  <fnm>WP</fnm>
               </au>
            </aug>
            <source>Genetics</source>
            <pubdate>1992</pubdate>
            <volume>132</volume>
            <fpage>583</fpage>
            <lpage>589</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">1205159</pubid>
                  <pubid idtype="pmpid" link="fulltext">1427045</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B87">
            <title>
               <p>A statistical test for detecting geographic subdivision.</p>
            </title>
            <aug>
               <au>
                  <snm>Hudson</snm>
                  <fnm>RR</fnm>
               </au>
               <au>
                  <snm>Boos</snm>
                  <fnm>DD</fnm>
               </au>
               <au>
                  <snm>Kaplan</snm>
                  <fnm>NL</fnm>
               </au>
            </aug>
            <source>Mol Biol Evol</source>
            <pubdate>1992</pubdate>
            <volume>9</volume>
            <fpage>138</fpage>
            <lpage>151</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">1552836</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B88">
            <title>
               <p>Methods for assessing the statistical significance of molecular sequence features by using general scoring schemes.</p>
            </title>
            <aug>
               <au>
                  <snm>Karlin</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Altschul</snm>
                  <fnm>SF</fnm>
               </au>
            </aug>
            <source>Proc Natl Acad Sci USA</source>
            <pubdate>1990</pubdate>
            <volume>87</volume>
            <fpage>2264</fpage>
            <lpage>2268</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">53667</pubid>
                  <pubid idtype="pmpid" link="fulltext">2315319</pubid>
                  <pubid idtype="doi">10.1073/pnas.87.6.2264</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B89">
            <title>
               <p>Applications and statistics for multiple high-scoring segments in molecular sequences.</p>
            </title>
            <aug>
               <au>
                  <snm>Karlin</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Altschul</snm>
                  <fnm>SF</fnm>
               </au>
            </aug>
            <source>Proc Natl Acad Sci USA</source>
            <pubdate>1993</pubdate>
            <volume>90</volume>
            <fpage>5873</fpage>
            <lpage>5877</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">46825</pubid>
                  <pubid idtype="pmpid" link="fulltext">8390686</pubid>
                  <pubid idtype="doi">10.1073/pnas.90.12.5873</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B90">
            <title>
               <p>The R Project for Statistical Computing</p>
            </title>
            <url>http://www.r-project.org</url>
         </bibl>
      </refgrp>
   </bm>
</art>

