<?xml version='1.0'?>
<!DOCTYPE art SYSTEM 'http://www.biomedcentral.com/xml/article.dtd'>
<art>
   <ui>gb-2003-4-2-r8</ui>
   <ji>GBJ</ji>
   <fm>
      <dochead>Research</dochead>
      <bibl>
         <title>
            <p>A search for doxycycline-dependent mutations that increase <it>Drosophila melanogaster </it>life span identifies the <it>VhaSFD, Sugar baby, filamin, fwd </it>and <it>Cctl </it>genes</p>
         </title>
         <aug>
            <au id="A1">
               <snm>Landis</snm>
               <mi>N</mi>
               <fnm>Gary</fnm>
               <insr iid="I1"/>
            </au>
            <au id="A2">
               <snm>Bhole</snm>
               <fnm>Deepak</fnm>
               <insr iid="I1"/>
               <insr iid="I2"/>
            </au>
            <au id="A3" ca="yes">
               <snm>Tower</snm>
               <fnm>John</fnm>
               <insr iid="I1"/>
               <email>jtower@USC.edu</email>
            </au>
         </aug>
         <insg>
            <ins id="I1">
               <p>Molecular and Computational Biology Program, Department of Biological Sciences, University of Southern California, 835 W 37th St, University Park, Los Angeles, CA 90089-1340, USA</p>
            </ins>
            <ins id="I2">
               <p>Current address: Department of Anesthesia, Brigham and Women's Hospital, Harvard Medical School, 75 Francis St, Boston, MA 02115, USA</p>
            </ins>
         </insg>
         <source>Genome Biology</source>
         <issn>1465-6906</issn>
         <pubdate>2003</pubdate>
         <volume>4</volume>
         <issue>2</issue>
         <fpage>R8</fpage>
         <url>http://genomebiology.com/2003/4/2/R8</url>
         <xrefbib>
            <pubidlist>
               <pubid idtype="doi">10.1186/gb-2003-4-2-r8</pubid>
               <pubid idtype="pmpid">12620118</pubid>
            </pubidlist>
         </xrefbib>
      </bibl>
      <history>
         <rec>
            <date>
               <day>18</day>
               <month>7</month>
               <year>2002</year>
            </date>
         </rec>
         <revrec>
            <date>
               <day>15</day>
               <month>11</month>
               <year>2002</year>
            </date>
         </revrec>
         <acc>
            <date>
               <day>11</day>
               <month>12</month>
               <year>2002</year>
            </date>
         </acc>
         <pub>
            <date>
               <day>30</day>
               <month>1</month>
               <year>2003</year>
            </date>
         </pub>
      </history>
      <cpyrt>
         <year>2003</year>
         <collab>Landis et al.; licensee BioMed Central Ltd. This is an Open Access article: verbatim copying and redistribution of this article are permitted in all media for any purpose, provided this notice is preserved along with the article's original URL.</collab>
      </cpyrt>
      <shorttitle>
         <p><it>Drosophila</it> life-span mutations</p>
      </shorttitle>
      <shortabs>
         <p>Screening for conditional mutations that increase <it>Drosophila </it>life span has identified genes implicated in membrane transport, phospholipid metabolism and signaling, and actin cytoskeleton organization.</p>
      </shortabs>
      <abs>
         <sec>
            <st>
               <p>Abstract</p>
            </st>
            <sec>
               <st>
                  <p>Background</p>
               </st>
               <p>A P-type transposable element called <it>PdL </it>has been engineered with a doxycycline-inducible promoter directed out through the 3' end of the element. Insertion of <it>PdL </it>near the 5' end of a gene often yields doxycycline-dependent overexpression of that gene and a mutant phenotype. This functional genomics strategy allows for efficient screening of large numbers of genes for overexpression phenotypes.</p>
            </sec>
            <sec>
               <st>
                  <p>Results</p>
               </st>
               <p><it>PdL </it>was mobilized to around 10,000 new locations in the <it>Drosophila melanogaster </it>genome and used to search for genes that would extend life span when overexpressed. Six lines were identified in which there was a 5-17% increase in life span in the presence of doxyxcycline. The mutations were molecularly characterized and in each case a gene was found to be overexpressed using northern blots. Two genes did not have previously known phenotypes and are implicated in membrane transport: <it>VhaSFD </it>encodes a regulatory subunit of the vacuolar ATPase proton pump (H<sup>+</sup>-ATPase), whereas <it>Sugar baby </it>(<it>Sug</it>) is related to a maltose permease from <it>Bacillus</it>. Three <it>PdL </it>mutations identified previously characterized genes: <it>filamin </it>encodes the homolog of an actin-polymerizing protein that interacts with presenilins. <it>four wheel drive </it>(<it>fwd</it>) encodes a phosphatidylinositol-4-kinase (PI 4-kinase) and <it>CTP:phosphocholine cytidylyltransferase-l </it>(<it>Cctl</it>) encodes the rate-limiting enzyme in phosphatidylcholine synthesis. Finally, an apparently novel gene (<it>Red herring, Rdh</it>) was found in the first intron of the <it>encore </it>gene.</p>
            </sec>
            <sec>
               <st>
                  <p>Conclusions</p>
               </st>
               <p>Screening for conditional mutations that increase <it>Drosophila </it>life span has identified genes implicated in membrane transport, phospholipid metabolism and signaling, and actin cytoskeleton organization.</p>
            </sec>
         </sec>
      </abs>
   </fm>
   <meta>
      <classifications>
         <classification type="BMC" subtype="man_spc_id" id="30010009">Genetics</classification>
         <classification type="BMC" subtype="man_spc_id" id="30010013">Methods</classification>
         <classification type="BMC" subtype="man_spc_id" id="30010005">Development</classification>
      </classifications>
   </meta>
   <bdy>
      <sec>
         <st>
            <p>Background</p>
         </st>
         <p><it>Drosophila melanogaster </it>has been a leading model for the study of aging for over 80 years [<abbr bid="B1">1</abbr>,<abbr bid="B2">2</abbr>,<abbr bid="B3">3</abbr>,<abbr bid="B4">4</abbr>,<abbr bid="B5">5</abbr>]. The intensive use of <it>Drosophila </it>as a model for developmental biology has produced a wealth of genetic and molecular biological tools that are readily adapted to the study of aging. Aging is associated with characteristic changes at the physiological and molecular level, however organismal life span is still the best measure of aging rate. The most successful studies of aging generally involve manipulations that increase life span. Experimental alterations of environment or genetic makeup that cause decreased life span might create novel diseases or pathologies that do not usually limit life span in a normal individual. In contrast, a manipulation that increases life span is thought to be more likely to identify mechanisms that normally limit the life span of the organism.</p>
         <p>Laboratory selection of <it>Drosophila </it>populations for late-life reproduction results in extended life span [<abbr bid="B6">6</abbr>,<abbr bid="B7">7</abbr>,<abbr bid="B8">8</abbr>]. The genetic selection experiments demonstrate that life span has a large genetic component and is highly plastic. Increased life span was generally correlated with increased stress resistance including increased oxidative stress resistance [<abbr bid="B9">9</abbr>,<abbr bid="B10">10</abbr>]. An important question in the study of aging in invertebrates is whether life span can be increased without a trade off with metabolic activity. Certain manipulations that decrease metabolic activity cause increased life span, such as lower culture temperature [<abbr bid="B11">11</abbr>]. In the genetic selection experiments, life span is increased without a reduction in metabolic activity [<abbr bid="B12">12</abbr>,<abbr bid="B13">13</abbr>].</p>
         <p>Single gene mutations have been identified that increase <it>Drosophila </it>life span. These mutations identify negative regulators of life span, as mutations expected to decrease activity of the gene lead to increased life span. <it>mth </it>encodes a protein related to G-protein coupled receptors, and appears to negatively regulate life span, stress resistance and body size [<abbr bid="B14">14</abbr>]. <it>Indy </it>is related to a mammalian cotransporter involved in membrane transport of Krebs cycle intermediates, leading to the suggestion that <it>Indy </it>mutations might increase life span by decreasing the availability of nutrients [<abbr bid="B15">15</abbr>].</p>
         <p>Certain mutant alleles of either the <it>Inr </it>or the <it>chico </it>genes can increase <it>Drosophila </it>life span [<abbr bid="B16">16</abbr>,<abbr bid="B17">17</abbr>]. <it>Inr </it>is homologous to the mammalian insulin receptor and insulin-like growth factor receptor, while <it>chico </it>is homologous to the mammalian insulin receptor substrate. The data indicate that an insulin-like signaling pathway negatively regulates life span, as had previously been found for the nematode <it>C. elegans </it>[<abbr bid="B18">18</abbr>]. This pathway for life span regulation may be even more highly conserved during evolution, as there are many similarities with life span regulation in mammals and in yeast. The increased life span regulated by the insulin-like signaling pathway in <it>C. elegans </it>is associated with increased resistance to stress, including oxidative stress [<abbr bid="B18">18</abbr>,<abbr bid="B19">19</abbr>,<abbr bid="B20">20</abbr>,<abbr bid="B21">21</abbr>]. This has led to suggestions that increased oxidative stress resistance and decreased amounts of oxidative damage may be the mechanism by which mutation of the insulin-like signaling pathway causes increased life span. Consistent with this idea, life-span extension in <it>C. elegans </it>is associated with increased expression of the gene encoding the mitochondrial antioxidant enzyme manganese-containing superoxide dismsutase (MnSOD) [<abbr bid="B22">22</abbr>]. In <it>Drosophila</it>, mutations of <it>chico </it>that extend life span increase total SOD enzyme activity; however, resistance to oxidative stress was not detectably increased, at least not as assayed by paraquat resistance [<abbr bid="B16">16</abbr>]. Therefore it remains to be determined if mutation of the insulin-like pathway in <it>Drosophila </it>increases life span by increasing SOD activity or by some other mechanism(s).</p>
         <p>Increased life span caused by overexpression of a gene by definition identifies a positive regulator of life span. Several genes involved in oxidative stress defense have been found to increase life span when overexpressed in transgenic flies. These include genes for both forms of SOD, the Cu/ZnSOD found in the cytoplasm and outer mitochondrial space, and MnSOD found in the inner mitochondrial space [<abbr bid="B23">23</abbr>,<abbr bid="B24">24</abbr>,<abbr bid="B25">25</abbr>]. These enzymes convert the most common oxygen radical produced by the mitochondria, superoxide, into hydrogen peroxide and water. Abundant catalase enzyme then converts the hydrogen peroxide into molecular oxygen and water. Overexpression of Cu/ZnSOD or MnSOD increases life span up to about 40%, and the amount of life span increase is found to be proportional to the amount of enzyme increase in each case. The life span increase caused by SOD overexpression is not associated with a detectable tradeoff in metabolic activity, as oxygen consumption was normal throughout the extended life span of the flies [<abbr bid="B24">24</abbr>]. Overexpression of the antioxidant enzyme peptide methionine sulfoxide reductase is also associated with increased life span [<abbr bid="B26">26</abbr>]. Finally, several genes implicated in repair and stress responses have been shown to be able to extend <it>Drosophila </it>life span when the flies are cultured at elevated temperatures [<abbr bid="B27">27</abbr>,<abbr bid="B28">28</abbr>,<abbr bid="B29">29</abbr>,<abbr bid="B30">30</abbr>].</p>
         <p>Testing specific genes by overexpression in transgenic flies is a candidate gene approach, meaning that the investigator must make an educated guess as to which genes are worth assaying by this relatively labor-intensive method. Recently genetic methods have been developed that allow for the efficient overexpression of random genes in <it>Drosophila</it>. P type transposable elements have been engineered to have transcriptional promoters directed out through the end of the element [<abbr bid="B31">31</abbr>,<abbr bid="B32">32</abbr>]. These elements will often insert upstream of gene coding regions, causing overexpression of the gene and mutant phenotypes. The <it>PdL </it>P element contains an outwardly directed tet-on promoter [<abbr bid="B33">33</abbr>,<abbr bid="B34">34</abbr>]. The transcription of this promoter is activated upon feeding the fly doxycycline, leading to conditional gene overexpression and conditional mutations. Conditional gene overexpression mutations have several potential advantages for study of aging and life span. By waiting until flies are young adults to activate gene overexpression, effects can be identified that are specific to adult aging. The system also provides powerful controls for genetic background effects, because control (no DOX) and over-expressing (+DOX) flies have identical genetic backgrounds and therefore any differences in life span must be due to DOX administration and gene overexpression. The <it>PdL </it>system allows the investigator to search for genes that can increase life span without having to guess ahead of time which genes these might be. Therefore the approach has the potential to identify genes and pathways not previously known or suspected to be involved in life span regulation.</p>
      </sec>
      <sec>
         <st>
            <p>Results</p>
         </st>
         <p>In the <it>rtTA </it>transgenic construct the powerful and tissue-general <it>actin5C </it>promoter drives expression of the rtTA transcriptional transactivator [<abbr bid="B33">33</abbr>]. When flies are fed doxycycline, rtTA binds to target sequences in the synthetic tet-on promoter in the <it>PdL </it>P element. This outwardly-directed promoter often causes overexpression of genes near the <it>PdL </it>insertion site and yields various mutant phenotypes [<abbr bid="B34">34</abbr>]. <it>PdL </it>is 8.4 kilobases (kb) long and contains the P element inverted repeats, the <it>mini-white+ </it>transformation marker gene, and the 500 base-pair (bp) tet-on promoter directed out through the 3' end of the element. The tet-on promoter contains no open reading frame (ORF) or translation initiation sequences. Therefore <it>PdL </it>must insert upstream of an endogenous translation intiation site (ATG) to cause overexpression of a protein. The transcripts initiated within <it>PdL </it>will therefore contain 280 bp of 5' untranslated sequence derived from <it>PdL </it>itself.</p>
         <p>To search for genes that might extend life span, new insertions of <it>PdL </it>were created on the second and third chromosomes by appropriate crosses to a strain expressing P element transposase (Figure <figr fid="F1">1</figr>). Approximately 10,000 males bearing a new <it>PdL </it>insert and an <it>rtTA </it>transcriptional transactivator insertion were generated. The males were generated in eight staggered groups, each of around 1,200 individuals. In an attempt to increase the variety of mutations identified, two different <it>rtTA </it>insertion strains were used. The first six cohorts of males contained an insertion of the <it>rtTA </it>construct called <it>rtTA(3)E2 </it>that is associated with moderate levels of target-gene expression and low levels of leaky expression in the absence of DOX [<abbr bid="B33">33</abbr>]. The last two cohorts of males contained an <it>rtTA </it>insertion called <it>rtTA(3)M1 </it>which is associated with a high level of target-gene expression and greater leaky expression. To obtain adult flies of defined age, the second cross was cultured at 25&#176;C in urine specimen bottles (Figure <figr fid="F1">1</figr>). Prior to eclosion of the majority of pupae, bottles were cleared of adults and flies were allowed to emerge over the next 48 hours. The majority of the males will have mated during this time. The males only were then removed and were designated 1 day old, and were maintained at 25&#176;C at 40 per vial in culture vials with food supplemented with 250 &#956;g/ml DOX, and passaged to new vials every 48 hours. The expectation was that some of these flies might live longer due to the overexpression of a beneficial gene. For the first four cohorts, at approximately 30% survival of the cohort, each of the males was individually mated with four third-chromosome balancer stock virgin females. This was so that a stable line could be recovered later if that fly was found to be one of the longest lived. Only about 21% of these males were found to be fertile, meaning that there was selection for males that maintained fertility during aging. After 4 days, the fertile males were removed from the crosses, placed in individual numbered vials, and passaged every two days until they were all dead. For the rest of the cohorts the males were mated at approximately 65% survival of the cohort, which increased the frequency of fertile males to about 32%. Stable lines were recovered for the approximately 1.4% longest-lived flies from each cohort. These 144 lines should therefore be enriched for ones in which <it>PdL </it>is causing overexpression of a gene with a benefit for life span. In addition, lines in which <it>PdL </it>causes overexpression of a gene with large negative effects on life span should have been eliminated by this step.</p>
         <fig id="F1">
            <title>
               <p>Figure 1</p>
            </title>
            <caption>
               <p>Genetic crossing strategy</p>
            </caption>
            <text>
               <p>Genetic crossing strategy. The starting <it>PdL </it>insertion on the X chromosome <it>PdL(X)A </it>was mobilized using the &#916;2-3 transposase source to generate approximately 10,000 new <it>PdL </it>insertions on the second and third chromosomes. Chromosomes potentially bearing new <it>PdL </it>insertions are indicated by asterisks and were recovered in males that also contained an <it>rtTA </it>transactivator construct. The males were allowed to age in the presence of DOX in staggered cohorts of approximately 1,200 each and were individually mated to balancer virgins. Stable <it>PdL </it>insertion lines were recovered for the longest-lived (approximately 1.4% of the males in each cohort). A total of 110 lines were identified using <it>rtTA </it>insertion <it>rtTA(3)E2</it>, and 34 lines with insertion <it>rtTA(3)M1</it>.</p>
            </text>
            <graphic file="gb-2003-4-2-r8-1"/>
         </fig>
         <p>Each of the 144 new <it>PdL </it>insertion lines was crossed to the appropriate <it>rtTA </it>chromosome strain, and males containing both constructs were assayed in large cohorts (around 400 flies) for doxycycline-dependent effects on life span (Figure <figr fid="F2">2</figr>). The mean life spans of the different strains in the absence of DOX varied greatly, from 40 to 84 days. Both increases and decreases were observed in the presence of DOX. For the 110 lines tested with <it>rtTA(3)E2 </it>there was an average 1.8% increase in the presence of DOX (Figure <figr fid="F2">2a</figr>), and for the 34 lines tested with <it>rtTA(3)M1 </it>an average 3.0% increase in the presence of DOX (Figure <figr fid="F2">2b</figr>), consistent with previous results that DOX itself has little to no effect on life span. However, several lines were identified where there was a significantly greater than average increase in life span in the presence of DOX. To confirm these results, these lines were assayed one or more additional times (Table <tblr tid="T1">1</tblr>). As a control, Oregon-R wild-type flies were repeatedly crossed to the <it>rtTA </it>strains and assayed for life span in parallel. The Oregon-R controls exhibited changes in life span from -5.14% to +4.71%, with an average change of +0.45%. In contrast, six <it>PdL </it>lines were found to yield significant and reproducible increases in life span in the presence of DOX, ranging from 5 to 17%.</p>
         <fig id="F2">
            <title>
               <p>Figure 2</p>
            </title>
            <caption>
               <p>Life-span assay of new <it>PdL </it>insertion lines</p>
            </caption>
            <text>
               <p>Life-span assay of new <it>PdL </it>insertion lines. The new <it>PdL </it>insertion lines were crossed to the appropriate <it>rtTA </it>insertion line, and male progeny were assayed for life span in the presence (+DOX) and absence of DOX (-DOX). Each line is represented by a pair of bars, black bars for -DOX and white bars for +DOX. <b>(a) </b>Lines crossed to <it>rtTA(3)E2</it>. The average life span -DOX was 64.7 days and the average +DOX was 65.9 days, for an average increase of 1.8%. <b>(b) </b>Lines crossed to <it>rtTA(3)M1</it>. The average life span -DOX was 59.4 days and the average +DOX was 61.2 days for an average increase of 3.0%.</p>
            </text>
            <graphic file="gb-2003-4-2-r8-2"/>
         </fig>
         <tbl id="T1">
            <title>
               <p>Table 1</p>
            </title>
            <caption>
               <p><it>PdL </it>lines</p>
            </caption>
            <tblbdy cols="6">
               <r>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c cspan="2" ca="center">
                     <p>Life-span phenotype*</p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c cspan="2">
                     <hr/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>Line name</p>
                  </c>
                  <c ca="left">
                     <p>Gene (enzyme)</p>
                  </c>
                  <c ca="center">
                     <p>-DOX</p>
                  </c>
                  <c ca="center">
                     <p>+DOX</p>
                  </c>
                  <c ca="center">
                     <p>% Change (<it>p</it>)</p>
                  </c>
                  <c ca="left">
                     <p>Date of assay</p>
                  </c>
               </r>
               <r>
                  <c cspan="6">
                     <hr/>
                  </c>
               </r>
               <r>
                  <c cspan="6" ca="left">
                     <p><it>PdL </it>lines crossed to <it>rtTA(3)E2</it></p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>
                        <it>PdL(3)3E36</it>
                     </p>
                  </c>
                  <c ca="left">
                     <p>
                        <it>Red herring/encore</it>
                     </p>
                  </c>
                  <c ca="center">
                     <p>60.42 &#177; 0.920</p>
                  </c>
                  <c ca="center">
                     <p>64.34 &#177; 0.864</p>
                  </c>
                  <c ca="center">
                     <p>+6.50 (0.0021)</p>
                  </c>
                  <c ca="left">
                     <p>7 October 1999</p>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="center">
                     <p>55.20 &#177; 0.729</p>
                  </c>
                  <c ca="center">
                     <p>64.55 &#177; 0.757</p>
                  </c>
                  <c ca="center">
                     <p>+16.95 (&lt;0.0001)</p>
                  </c>
                  <c ca="left">
                     <p>6 July 1999</p>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="center">
                     <p>66.91 &#177; 0.980</p>
                  </c>
                  <c ca="center">
                     <p>75.59 &#177; 0.910</p>
                  </c>
                  <c ca="center">
                     <p>+13.00 (&lt;0.0001)</p>
                  </c>
                  <c ca="left">
                     <p>14 February 2001</p>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="center">
                     <p>56.56 &#177; 0.709</p>
                  </c>
                  <c ca="center">
                     <p>62.44 &#177; 0.854</p>
                  </c>
                  <c ca="center">
                     <p>+10.38 (&lt;0.0001)</p>
                  </c>
                  <c ca="left">
                     <p>7 August 2001</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>
                        <it>PdL(2)4G14</it>
                     </p>
                  </c>
                  <c ca="left">
                     <p>
                        <it>VhaSFD</it>
                     </p>
                  </c>
                  <c ca="center">
                     <p>76.05 &#177; 1.039</p>
                  </c>
                  <c ca="center">
                     <p>82.71 &#177; 1.088</p>
                  </c>
                  <c ca="center">
                     <p>+8.75 (&lt;0.0001)</p>
                  </c>
                  <c ca="left">
                     <p>14 November 2000</p>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="center">
                     <p>69.28 &#177; 1.077</p>
                  </c>
                  <c ca="center">
                     <p>76.24 &#177; 1.538</p>
                  </c>
                  <c ca="center">
                     <p>+10.6 (0.0002)</p>
                  </c>
                  <c ca="left">
                     <p>18 July 2000</p>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="center">
                     <p>73.79 &#177; 1.410</p>
                  </c>
                  <c ca="center">
                     <p>77.67 &#177; 1.251</p>
                  </c>
                  <c ca="center">
                     <p>+5.27 (0.0404)</p>
                  </c>
                  <c ca="left">
                     <p>6 March 2001</p>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="center">
                     <p>55.40 &#177; 0.810</p>
                  </c>
                  <c ca="center">
                     <p>59.34 &#177; 0.887</p>
                  </c>
                  <c ca="center">
                     <p>+7.11 (0.0011)</p>
                  </c>
                  <c ca="left">
                     <p>21 August 2001</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>
                        <it>PdL(3)2C33</it>
                     </p>
                  </c>
                  <c ca="left">
                     <p>
                        <it>Sugar baby CG7334</it>
                     </p>
                  </c>
                  <c ca="center">
                     <p>73.91 &#177; 1.501</p>
                  </c>
                  <c ca="center">
                     <p>80.32 &#177; 1.392</p>
                  </c>
                  <c ca="center">
                     <p>+8.67 (0.0019)</p>
                  </c>
                  <c ca="left">
                     <p>15 November 2000</p>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="center">
                     <p>71.75 &#177; 1.105</p>
                  </c>
                  <c ca="center">
                     <p>77.74 &#177; 1.169</p>
                  </c>
                  <c ca="center">
                     <p>+8.35 (0.0002)</p>
                  </c>
                  <c ca="left">
                     <p>3 July 2000</p>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="center">
                     <p>68.99 &#177; 1.100</p>
                  </c>
                  <c ca="center">
                     <p>72.22 &#177; 1.034</p>
                  </c>
                  <c ca="center">
                     <p>+4.68 (0.0329)</p>
                  </c>
                  <c ca="left">
                     <p>6 March 2001</p>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="center">
                     <p>56.77 &#177; 0.950</p>
                  </c>
                  <c ca="center">
                     <p>57.68 &#177; 0.617</p>
                  </c>
                  <c ca="center">
                     <p>+1.59 (0.4241)</p>
                  </c>
                  <c ca="left">
                     <p>7 August 2001</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>Oregon-R</p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="center">
                     <p>62.70 &#177; 0.963</p>
                  </c>
                  <c ca="center">
                     <p>63.81 &#177; 1.299</p>
                  </c>
                  <c ca="center">
                     <p>+1.76 (0.4954)</p>
                  </c>
                  <c ca="left">
                     <p>12 August 2001</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>Oregon-R</p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="center">
                     <p>68.20 &#177; 0.978</p>
                  </c>
                  <c ca="center">
                     <p>71.41 &#177; 1.255</p>
                  </c>
                  <c ca="center">
                     <p>+4.71 (0.0438)</p>
                  </c>
                  <c ca="left">
                     <p>28 September 2000</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>Oregon-R</p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="center">
                     <p>71.27 &#177; 1.407</p>
                  </c>
                  <c ca="center">
                     <p>72.46 &#177; 1.247</p>
                  </c>
                  <c ca="center">
                     <p>+1.66 (0.5278)</p>
                  </c>
                  <c ca="left">
                     <p>11 July 2000</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>Oregon-R</p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="center">
                     <p>76.14 &#177; 1.498</p>
                  </c>
                  <c ca="center">
                     <p>74.45 &#177; 1.492</p>
                  </c>
                  <c ca="center">
                     <p>-2.23 (0.4236)</p>
                  </c>
                  <c ca="left">
                     <p>16 May 2000</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>Oregon-R</p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="center">
                     <p>68.84 &#177; 0.903</p>
                  </c>
                  <c ca="center">
                     <p>65.30 &#177; 1.175</p>
                  </c>
                  <c ca="center">
                     <p>-5.14 (0.0176)</p>
                  </c>
                  <c ca="left">
                     <p>7 October 1999</p>
                  </c>
               </r>
               <r>
                  <c cspan="6" ca="left">
                     <p><it>PdL </it>lines crossed to <it>rtTA(3)M1</it></p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>
                        <it>PdL(3)8S64</it>
                     </p>
                  </c>
                  <c ca="left">
                     <p>
                        <it>filamin</it>
                     </p>
                  </c>
                  <c ca="center">
                     <p>58.87 &#177; 1.295</p>
                  </c>
                  <c ca="center">
                     <p>64.11 &#177; 1.066</p>
                  </c>
                  <c ca="center">
                     <p>+8.76 (0.0020)</p>
                  </c>
                  <c ca="left">
                     <p>13 December 2000</p>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="center">
                     <p>56.00 &#177; 1.202</p>
                  </c>
                  <c ca="center">
                     <p>60.68 &#177; 1.103</p>
                  </c>
                  <c ca="center">
                     <p>+8.37 (0.0044)</p>
                  </c>
                  <c ca="left">
                     <p>3 May 2001</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>
                        <it>PdL(3)8S25</it>
                     </p>
                  </c>
                  <c ca="left">
                     <p>
                        <it>fwd</it>
                     </p>
                  </c>
                  <c ca="center">
                     <p>58.90 &#177; 0.868</p>
                  </c>
                  <c ca="center">
                     <p>62.99 &#177; 0.912</p>
                  </c>
                  <c ca="center">
                     <p>+6.93 (0.0013)</p>
                  </c>
                  <c ca="left">
                     <p>22 December 2000</p>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c ca="left">
                     <p>(1-phosphatidylinositol 4-kinase)</p>
                  </c>
                  <c ca="center">
                     <p>56.25 &#177; 0.940</p>
                  </c>
                  <c ca="center">
                     <p>61.31 &#177; 1.028</p>
                  </c>
                  <c ca="center">
                     <p>+9.00 (0.0003)</p>
                  </c>
                  <c ca="left">
                     <p>3 May 2001</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>
                        <it>PdL(3)8R128</it>
                     </p>
                  </c>
                  <c ca="left">
                     <p>
                        <it>Cct1</it>
                     </p>
                  </c>
                  <c ca="center">
                     <p>59.68 &#177; 1.192</p>
                  </c>
                  <c ca="center">
                     <p>64.34 &#177; 1.052</p>
                  </c>
                  <c ca="center">
                     <p>+7.80 (0.0035)</p>
                  </c>
                  <c ca="left">
                     <p>27 February 2001</p>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c ca="left">
                     <p>(cholinephosphate cytidylyltransferase)</p>
                  </c>
                  <c ca="center">
                     <p>56.54 &#177; 0.789</p>
                  </c>
                  <c ca="center">
                     <p>59.85 &#177; 0.852</p>
                  </c>
                  <c ca="center">
                     <p>+5.93 (0.0041)</p>
                  </c>
                  <c ca="left">
                     <p>10 July 2001</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>Oregon-R</p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="center">
                     <p>60.44 &#177; 1.296</p>
                  </c>
                  <c ca="center">
                     <p>61.61 &#177; 1.350</p>
                  </c>
                  <c ca="center">
                     <p>-1.96 (0.5337)</p>
                  </c>
                  <c ca="left">
                     <p>13 July 2001</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>Oregon-R</p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="center">
                     <p>65.79 &#177; 1.009</p>
                  </c>
                  <c ca="center">
                     <p>68.68 &#177; 0.819</p>
                  </c>
                  <c ca="center">
                     <p>+4.39 (0.0266)</p>
                  </c>
                  <c ca="left">
                     <p>2 May 2001</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>Oregon-R</p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="center">
                     <p>65.45 &#177; 1.304</p>
                  </c>
                  <c ca="center">
                     <p>66.93 &#177; 1.091</p>
                  </c>
                  <c ca="center">
                     <p>+2.20 (0.3824)</p>
                  </c>
                  <c ca="left">
                     <p>30 November 2000</p>
                  </c>
               </r>
            </tblbdy>
            <tblfn>
               <p>*Mean life span &#177; SEM, <it>p</it>-value for unpaired, two-sided <it>t</it>-test in parentheses.</p>
            </tblfn>
         </tbl>
         <p>Line <it>PdL(3)3E36 </it>was associated with the largest increase in life span (average 12%) (Table <tblr tid="T1">1</tblr>). The <it>PdL </it>insert in this line was located in the large first intron of the <it>encore </it>gene [<abbr bid="B35">35</abbr>], with the promoter oriented in the sense direction (Figure <figr fid="F3">3a</figr>). <it>PdL </it>caused the expression of a pair of approximately 1.4 kb transcripts that contain a 44 amino acid ORF identified by the <it>Drosophila </it>genome project as <it>CG14975</it>, as determined by northern blot with a <it>CG14975 </it>probe. These transcripts were not detected in the absence of DOX in the adult males and this putative gene was named <it>Red herring </it>(<it>Rdh</it>). Northern analysis using a probe from <it>encore </it>exon 3 indicated that levels of the normal sized <it>encore </it>transcript were not detectably altered by DOX, as indicated by the arrowhead (Figure <figr fid="F3">3a</figr>). However, DOX appeared to induce expression of both larger and smaller RNAs containing <it>encore </it>coding-region sequences, resulting in a smear of hybridization in the upper part of the lane, as indicated by the asterisk. Representative survival curves are presented (Figure <figr fid="F3">3a</figr>).</p>
         <fig id="F3">
            <title>
               <p>Figure 3</p>
            </title>
            <caption>
               <p>Characterization of new <it>PdL </it>mutations</p>
            </caption>
            <text>
               <p>Characterization of new <it>PdL </it>mutations. <b>(a) </b><it>PdL(3)3E36 </it>(<it>Red herring </it>and <it>encore </it>(<it>enc</it>)); <b>(b) </b><it>PdL(2)4G14 </it>(<it>VhaSFD</it>); <b>(c) </b><it>PdL(3)2C33 </it>(<it>Sugar baby</it>); <b>(d) </b><it>PdL(3)8S64 </it>(<it>filamin</it>); <b>(e) </b><it>PdL(3)8S25 </it>(<it>four wheel drive </it>(<it>fwd</it>)); <b>(f) </b><it>PdL(3)8R128 </it>(<it>CTP:phosphocholine cytidylyltransferase-1 </it>(<it>Cct1</it>)). The molecular organization of each mutated gene is diagrammed. The <it>PdL </it>insertion is indicated by a triangle, with an arrow indicating the direction of transcription of the <it>PdL </it>tet-on promoter. Transcript start sites and ATG translation start codons are marked by arrows. The location of <it>PdL </it>insertions, transcription start sites, ATG translation start sites, and transcript termination sites are indicated by genomic scaffold numbers. mRNA was isolated from whole adult male flies cultured &#177;DOX and analyzed by northern blot. Hybridization with ribosomal protein gene <it>Rp49 </it>probe was used as a loading control. The locations of gene-specific DNA probes used for northern analyses are indicated. Transcript sizes were estimated using RNA markers run in adjacent lanes (data not shown). Two representative survival curves are presented for each line.</p>
            </text>
            <graphic file="gb-2003-4-2-r8-3"/>
         </fig>
         <p>Line <it>PdL(2)4G14 </it>contains an insert at the 5' end of the <it>VhaSFD </it>gene, encoding the vacuolar proton pump ATPase (H<sup>+</sup>-ATPase) SFD subunit [<abbr bid="B36">36</abbr>]. DOX caused an approximately fourfold overexpression of the <it>VhaSFD </it>transcript and an average 8% increase in life span (Figure <figr fid="F3">3b</figr>). Representative survival curves for the <it>PdL(2)4G14 </it>line are presented (Figure <figr fid="F3">3b</figr>). Line <it>PdL(3)2C33 </it>contains an insert at the 5' end of a gene with homology to a maltose permease from <it>Bacillus stearothermophilus </it>[<abbr bid="B37">37</abbr>], which was named <it>Sugar baby </it>(Figure <figr fid="F3">3c</figr>). DOX caused an approximately 8.5-fold overexpression of the <it>Sugar baby </it>transcript, and was associated with an average 6% increase in life span.</p>
         <p>Three genes with previously characterized mutant phenotypes were also identified by <it>PdL </it>insertions. Line <it>PdL(3)8S64 </it>contained an insert at the 5' end of the <it>filamin </it>gene 'A' transcript (Figure <figr fid="F3">3d</figr>). Filamin is an actin-binding protein involved in cytokinesis and ring canal formation [<abbr bid="B38">38</abbr>,<abbr bid="B39">39</abbr>]. <it>filamin A </it>was overexpressed approximately fivefold in the presence of DOX and associated with an average 8.5% increase in life span. Expression of the <it>filamin </it>'B' transcript was not detectably altered. Line <it>PdL(3)8S25 </it>contained an insert at the 5' end of the 'B' transcript of the <it>four wheel drive </it>(<it>fwd</it>) gene (Figure <figr fid="F3">3e</figr>). <it>fwd </it>encodes a 1-phosphatidylinositol 4-kinase (PI 4-kinase) that regulates actin organization and ring canal formation during germline cytokinesis [<abbr bid="B40">40</abbr>]. <it>fwd </it>B was overexpressed approximately 10-fold and associated with an average 8% increase in life span. Finally, line <it>PdL(3)8R128 </it>had an insert at the 5' end of the <it>CTP:phosphocholine cytidylyltransferase 1 </it>(<it>Cct1</it>) gene (Figure <figr fid="F3">3f</figr>). <it>Cct1 </it>encodes a homolog of the rate-limiting enzyme in phosphatidylcholine biosynthesis [<abbr bid="B41">41</abbr>]. <it>Cct1 </it>was overexpressed approximately 1.7-fold and was associated with an average 7% increase in life span.</p>
      </sec>
      <sec>
         <st>
            <p>Discussion</p>
         </st>
         <p>The genetic screen described here had several unusual aspects, and the potential to identify a novel set of genes involved in life-span regulation. First, the screen was designed to identify positive regulators of life span, that is, genes that will increase life span when overexpressed. Most genetic screens for life-span regulators in <it>Drosophila </it>and other organisms, such as <it>C. elegans</it>, have involved loss-of-function mutations and therefore have identified negative regulators of life span [<abbr bid="B14">14</abbr>,<abbr bid="B15">15</abbr>,<abbr bid="B42">42</abbr>,<abbr bid="B43">43</abbr>]. Second, mutants were identified on the basis of the phenotype of increased life span under normal conditions, as opposed to some surrogate phenotype expected to correlate with life span, such as increased stress resistance. Because the <it>PdL </it>mutations generated here were screened directly for extended life span under normal conditions, the screen had the potential to identify genes and pathways not previously suspected to have a role in aging and life-span regulation.</p>
         <p>Results were reported recently for a screen for positive regulators of life span using a different P-element-based gene overexpression strategy [<abbr bid="B29">29</abbr>]. In that study a heat-stress inducible system was used, and lines were screened for life span at the moderate heat stress condition of 30&#176;C. Several genes were identified that increased survival when overexpressed, including genes involved in heat stress and oxidative stress responses. It is interesting to note that there is no overlap with the genes identified here with <it>PdL </it>at 25&#176;C. This may be due to the small fraction of the genome that has been tested so far, or it may indicate that different mechanisms limit life span under normal and moderate heat-stress conditions.</p>
         <p>It is difficult to estimate the number of genes that were tested in the <it>PdL </it>screen, but it is certain to have been only a tiny fraction of the genome. In previous experiments approximately 7% of <it>PdL </it>insertions were found to cause lethal and visible phenotypes when the <it>PdL </it>promoter was activated during larval and pupal development [<abbr bid="B34">34</abbr>]. Seven percent is certainly a large underestimate of the frequency at which genes are overexpressed, as embryogenesis was not tested, and not all genes will be lethal or have an obvious visible phenotype when overexpressed. The original 10,000 <it>PdL </it>insertions generated here went through an initial enrichment step of unknown efficiency, to yield the 144 lines that were tested in large cohorts. Lines in which a gene was overexpressed that had a positive effect on life span should have been enriched in the final 144 lines, whereas ones with a significant negative effect should have been eliminated. The enrichment step appears to have been at least partially successful, as the largest negative effect on life span observed among the 144 lines tested was -7.5%, and <it>PdL </it>is known to be able to create mutations with negative effects of up to -30% [<abbr bid="B34">34</abbr>]. The molecular characterization of the mutations suggests a low frequency of false positives. If the six <it>PdL </it>insertion strains were a random set, then <it>PdL </it>would be expected to sometimes be in the wrong orientation and/or downstream of the ATG translation start. However, all six lines were found to have <it>PdL </it>insertions at the 5' end of a gene and oriented in the sense direction, and in all six lines a transcript was overexpressed that was expected to contain a complete ORF.</p>
         <p>The magnitude of life-span increases caused by the <it>PdL </it>mutations was generally small, ranging from 5 to 17%. This is in contrast to overexpression of SOD genes or certain single gene mutations such as <it>mth</it>, where life-span increases range from 20 to 50% [<abbr bid="B14">14</abbr>,<abbr bid="B23">23</abbr>,<abbr bid="B24">24</abbr>,<abbr bid="B25">25</abbr>]. There are at least two possible reasons for the relatively small life span increases observed here. First, as only a fraction of the genome has been tested, it may be that genes with larger effects exist but have not yet been identified. Second, the tet-on system is sometimes leaky, meaning that at certain genomic locations there can be significant expression of the tet-on promoter in the absence of DOX [<abbr bid="B33">33</abbr>]. It is possible that in some of the lines the increase in life span between -DOX and +DOX is reduced because there is already some gene overexpression and life-span extension in the -DOX flies. Such a line might be expected to have an unusually high -DOX life span relative to the other lines, and it is notable that this appears to be the case for the lines bearing mutations in the <it>VhaSFD </it>and <it>Sugar baby </it>genes. When this difference is included in the calculations, the life span increases for <it>VhaSFD </it>and <it>Sugar baby </it>are approximately 20% and 17%, respectively.</p>
         <p>The largest average increase in life span caused by DOX (12%) was obtained for the <it>PdL(2)3E36 </it>insertion in the large first intron of the <it>encore </it>gene. A pair of approximately 1.4 kb transcripts was expressed containing a 44 amino acid ORF with no detectable homologies. While there are a number of <it>Drosophila </it>genes encoding functional ORFs of this size, it is also possible that these transcripts do not encode a functional protein but rather function at the RNA level to affect life span. There are no cDNAs in the databases containing these intronic sequences, and we were unable to detect these transcripts in wild-type adult males using northern blots. The data suggest that these transcripts are not expressed under normal conditions, or are expressed at very low levels. Further experiments will be required to determine the mechanism of life-span extension in this line, and the elusive nature of the intronic gene suggested the name <it>Red herring</it>. The northern analyses also indicated induction of a small amount of a large transcript containing the <it>encore </it>coding region. Therefore it is also possible that the life span extension in this line is caused by an increase in the expression of <it>encore</it>, encore is a member of a novel family of proteins with multiple functions during <it>Drosophila </it>oogenesis [<abbr bid="B44">44</abbr>].</p>
         <p>Two of the genes identified appear to be involved in membrane transport. The <it>VhaSFD </it>gene encodes the <it>Drosophila </it>homolog of the vacuolar H<sup>+</sup>-ATPase SFD subunit. The vacuolar ATPase is an ATP-driven proton pump found in the endomembranes of eukaryotic cells [<abbr bid="B36">36</abbr>,<abbr bid="B45">45</abbr>,<abbr bid="B46">46</abbr>,<abbr bid="B47">47</abbr>]. It is composed of a cytoplasmic ATPase domain called V<sub>1 </sub>that contains VhaSFD and other subunits, and a multisubunit membrane-channel component called V<sub>0</sub>. The vacuolar ATPase is involved in the acidification and energization of organelles such as Golgi-derived vesicles, clathrin-coated vesicles, synaptic vesicles and lysosomes. The proton pumping is required for processes such as protein trafficking, receptor-mediated endocytosis, neurotransmitter release and intracellular pH regulation and waste management. The free membrane V<sub>0 </sub>domain has also been implicated in membrane fusion events. In higher organisms the vacuolar H<sup>+</sup>-ATPase is also found in the plasma membrane of specialized epithelial cells where it functions in bulk transport. In <it>Drosophila </it>this is the Malpighian (or renal) tubule. The VhaSFD subunit is required for the ATPase activity and assembly of the vacuolar H<sup>+</sup>-ATPase and may function as a dissociable regulatory subunit. Therefore, overexpression of <it>VhaSFD </it>may affect life span by increasing activity of the vacuolar H<sup>+</sup>-ATPase.</p>
         <p>The <it>Sugar baby </it>gene is related to a maltose permease from <it>Bacillus stearothermophilus </it>[<abbr bid="B37">37</abbr>], suggesting that it may function in transport of maltose or other sugars across a membrane. Recently, loss-of-function mutations in another putative membrane transporter, <it>Indy</it>, have been found to increase life span [<abbr bid="B15">15</abbr>]. It is possible that overexpression of the putative transporter encoded by <it>Sugar baby </it>could increase life span by increasing uptake of a particular sugar and altering energy metabolism pathways.</p>
         <p>Filamin is an actin-binding protein with a homolog in humans called actin-binding protein 280 (ABP280) [<abbr bid="B38">38</abbr>,<abbr bid="B39">39</abbr>]. Filamin binds to several cell-membrane proteins and intercellular ligands involved in signal transduction, and appears to act as a downstream effector in remodeling of the actin cytoskeleton. During <it>Drosophila </it>oogenesis, filamin localizes to the ring canals, which are membrane-associated actin cytoskeletal structures that create intercellular bridges between germline cells. Loss-of-function mutations of <it>filamin </it>disrupt the normal function of these actin cytoskeletal structures. Filamin has several additional interactions with potential relevance to aging studies. Presenilins are membrane proteins found in both humans and <it>Drosophila</it>, and mutations in human presenilins are associated with early onset familial Alzheimer's disease (FAD) [<abbr bid="B48">48</abbr>]. <it>Drosophila </it>filamin binds to both <it>Drosophila </it>and human presenilins, and <it>filamin </it>interacts genetically with <it>presenilin </it>in <it>Drosophila </it>[<abbr bid="B49">49</abbr>]. Dominant adult phenotypes produced in <it>Drosophila </it>by overexpression of <it>presenilin </it>can be suppressed by overexpression of <it>filamin</it>. Filamin also interacts specifically with <it>Drosophila </it>Toll and Tube proteins [<abbr bid="B50">50</abbr>]. Toll and Tube are members of a signal transduction pathway that activates the Rel transcription factor Dorsal and is involved in developmental patterning and in the adult immune response. Several of the immune-response genes regulated by Rel transcription factors are dramatically induced during <it>Drosophila </it>aging (G.L., J. Carrick and J.T., unpublished data).</p>
         <p><it>fwd </it>encodes a phosphatidylinositol 4-kinase (PI 4-kinase) that converts phosphatidylinositol (PI) to phosphatidylinositol 4-phosphate (PIP) [<abbr bid="B40">40</abbr>]. This is the first step in the synthesis of the key regulatory membrane phospholipid PIP2, which is generated from PIP by a PI 4,5-kinase. PIP2 interacts directly with a number of proteins, regulating both their sub-cellular localization and their activity. Data from yeast and mammalian systems implicates homologous PI 4-kinases and PIP2 in regulation of secretion and membrane vesicle trafficking [<abbr bid="B51">51</abbr>,<abbr bid="B52">52</abbr>]. In <it>Drosophila, fwd </it>gene function is required for the formation of ring canals and cytoplasmic bridges during cytokinesis in male meiosis. PIP2 is also the precursor to the important second messengers PIP3 and diacylglycerol. PIP3 is involved in the insulin-like signaling pathway that affects life span in <it>Drosophila </it>and <it>C. elegans </it>[<abbr bid="B53">53</abbr>], and it will be of interest to determine if <it>fwd </it>overexpression is somehow affecting this pathway.</p>
         <p>CTP:phosphocholine cytidylyltransferase (Cct) catalyzes the conversion of phosphocholine to CDP-choline and is the rate-limiting enzyme in the phosphatidylcholine biosynthetic pathway [<abbr bid="B41">41</abbr>]. Phosphatidylcholine is a major membrane phospholipid and is a precursor to second messengers involved in signal transduction at the membrane, including the PIP, PIP2 and PIP3 discussed above. There are two genes encoding Cct in <it>Drosophila </it>(<it>Cct1 </it>and <it>Cct2</it>), and mutations in the <it>Cct1 </it>gene disrupt patterning during oogenesis (T. Gupta and T. Schupbach, personal communication). Overexpression of <it>Cct1 </it>might affect life span by increasing synthesis of phosphatidylcholine and altering membrane structure and/or phospholipid signaling pathways.</p>
         <p>It is striking that most of the genes identified in this screen as positive regulators of <it>Drosophila </it>life span are implicated in functions at the membrane, including regulation of transport, phospholipid metabolism, signal transduction and actin cytoskeleton organization. It is tempting to speculate that some of these genes may be acting in the same pathway(s) for life-span regulation. For example, both <it>filamin </it>and <it>fwd </it>are involved in the function of ring canals, which are membrane-associated actin cytoskeletal structures that create intercellular bridges between germline cells during early mitotic divisions [<abbr bid="B38">38</abbr>,<abbr bid="B39">39</abbr>,<abbr bid="B40">40</abbr>]. <it>encore </it>is also required for normal early mitotic division of the germline cells [<abbr bid="B44">44</abbr>]. In <it>C. elegans</it>, germline cells have recently been shown to send signals that regulate life span of the adult organism [<abbr bid="B54">54</abbr>,<abbr bid="B55">55</abbr>,<abbr bid="B56">56</abbr>], and it will be of interest to determine if any of the genes identified here increase life span through effects on the germline. Both <it>fwd </it>and <it>Cct1 </it>are involved in phospholipid metabolism, and phospholipid signaling pathways are implicated in life-span regulation in <it>Drosophila </it>and other organisms [<abbr bid="B53">53</abbr>]. The conserved insulin-like life-span regulatory pathway includes a PI 3-kinase that converts PIP2 into PIP3. The enzymes encoded by <it>fwd </it>and <it>Cct1 </it>are both in the biosynthetic pathway for PIP2 and therefore might affect the insulin-like pathway by altering the availability of this substrate. Further experiments will be required to confirm the role of these genes in life-span regulation, and to determine their interactions with each other and in known or novel life-span regulatory pathways.</p>
      </sec>
      <sec>
         <st>
            <p>Materials and methods</p>
         </st>
         <sec>
            <st>
               <p><it>Drosophila </it>strains</p>
            </st>
            <p>All <it>D. melanogaster </it>strains are as described [<abbr bid="B33">33</abbr>,<abbr bid="B34">34</abbr>,<abbr bid="B57">57</abbr>,<abbr bid="B58">58</abbr>].</p>
         </sec>
         <sec>
            <st>
               <p><it>Drosophila </it>culture and life-span assays</p>
            </st>
            <p><it>Drosophila </it>were cultured on standard agar/molasses/corn meal/yeast media [<abbr bid="B59">59</abbr>]. To obtain adult flies of defined age, the indicated <it>PdL </it>lines and Oregon-R control strain were crossed to an <it>rtTA </it>stock and cultured at 25&#176;C in urine specimen bottles. Prior to eclosion of the majority of pupae, bottles were cleared of adults and newly eclosed flies were allowed to emerge over the next 48 h. The majority of the males will have mated during this time. The males only were then removed and were designated 1 day old, and were maintained at 25&#176;C at 40 per vial in culture vials with food. At 4 days of age the males were split into control and experimental groups of 200 males each, with experimentals (+DOX) placed on culture media supplemented with 250 &#956;g/ml DOX. Dead flies were counted at each passage, and the number of vials was progressively reduced to maintain approximately 40 flies per vial. To calculate mean life spans for the experimental (+DOX) and control (-DOX) cohorts, each fly's life span was tabulated and their life spans were averaged and the standard error of the mean (SEM) calculated. Statistical significance of differences in mean life span was calculated for each experiment using unpaired two-sided <it>t </it>tests.</p>
         </sec>
         <sec>
            <st>
               <p>ANOVA</p>
            </st>
            <p>Two-way analysis of variance (ANOVA) was performed for each life-span dataset. The first dataset was the 110 lines crossed to <it>rtTA(3)E2 </it>(Figure <figr fid="F2">2a</figr>). Sources of variance were line, treatment (DOX), and line &#215; treatment. Results are presented in Table <tblr tid="T2">2</tblr>. A <it>P</it>-value &#8804; 0.05 was considered statistically significant. The significant line &#215; treatment interaction for dataset 1 indicated that DOX affects life span only in certain lines. The significance and 95% confidence interval were calculated for each line with experiment-wise error rate for multiple comparisons reduced using the Bonferroni method (see supplemenetary table in Additional data files). DOX decreased life span in 6 lines and increased it in 34 lines. The second dataset was the 34 lines crossed to <it>rtTA(3)M1 </it>(Figure <figr fid="F2">2b</figr>). Results were line <it>F </it>= 57.168, <it>p </it>&lt; 0.001; treatment <it>F </it>= 48.131, <it>p </it>&lt; 0.001; line &#215; treatment <it>F </it>= 1.898, <it>p </it>= 0.001. The significant line &#215; treatment interaction again indicates that DOX affects life span only in certain lines. The significance and 95% confidence interval were calculated for each line, with experiment-wise error rate reduced using the Bonferroni method (see supplementary table in Additional data files). DOX decreased life span in one line, and increased it in seven lines.</p>
         </sec>
         <tbl id="T2">
            <title>
               <p>Table 2</p>
            </title>
            <caption>
               <p>ANOVA results for 110 lines crossed to <it>rtTA(3)E2</it></p>
            </caption>
            <tblbdy cols="5">
               <r>
                  <c ca="left">
                     <p>Source</p>
                  </c>
                  <c ca="center">
                     <p>Degrees of freedom</p>
                  </c>
                  <c ca="center">
                     <p>Mean square</p>
                  </c>
                  <c ca="center">
                     <p>
                        <it>F</it>
                     </p>
                  </c>
                  <c ca="center">
                     <p>
                        <it>p</it>
                     </p>
                  </c>
               </r>
               <r>
                  <c cspan="5">
                     <hr/>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>Line</p>
                  </c>
                  <c ca="center">
                     <p>109</p>
                  </c>
                  <c ca="center">
                     <p>30,407.071</p>
                  </c>
                  <c ca="center">
                     <p>134.854</p>
                  </c>
                  <c ca="center">
                     <p>&lt; 0.001</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>Treatment</p>
                  </c>
                  <c ca="center">
                     <p>1</p>
                  </c>
                  <c ca="center">
                     <p>19,763.341</p>
                  </c>
                  <c ca="center">
                     <p>87.650</p>
                  </c>
                  <c ca="center">
                     <p>&lt; 0.001</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>Line &#215; treatment</p>
                  </c>
                  <c ca="center">
                     <p>109</p>
                  </c>
                  <c ca="center">
                     <p>720.007</p>
                  </c>
                  <c ca="center">
                     <p>3.193</p>
                  </c>
                  <c ca="center">
                     <p>&lt; 0.001</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>Error</p>
                  </c>
                  <c ca="center">
                     <p>40,129</p>
                  </c>
                  <c ca="center">
                     <p>225.481</p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
               </r>
            </tblbdy>
         </tbl>
         <p>Each line in which DOX increased life span was crossed to the appropriate <it>rtTA </it>strain and assayed one to three additional times. For six lines there was a reproducible increase in life span with DOX (Table <tblr tid="T1">1</tblr>). As an additional control, Oregon-R wild-type was repeatedly crossed to <it>rtTA(3)E3 </it>and to <it>rtTA(3)M1 </it>strains and assayed for life span in the presence or absence of DOX. These datasets were analyzed using two-way ANOVA with date of assay, treatment (DOX), and date &#215; treatment as the sources of variance. Dataset 3 was the four independent assays of line <it>PdL(3)3E36 </it>(<it>Red herring/encore</it>) (Table <tblr tid="T1">1</tblr>). Results were date <it>F </it>= 100.690, <it>p </it>&lt; 0.001; treatment <it>F </it>= 129.780, <it>p </it>&lt; 0.001; and date &#215; treatment <it>F </it>= 5.387, <it>p </it>= 0.001. Dataset 4 was the four independent assays of line <it>PdL(2)4G14 </it>(<it>VhaSFD</it>). Results were date <it>F </it>= 145.348, <it>p </it>&lt; 0.001, treatment <it>F </it>= 43.294, <it>p </it>&lt; 0.001, date &#215; treatment <it>F </it>= 1.057, <it>p </it>= 0.366. Dataset 5 was the four independent assays of line <it>PdL(3)2C33 </it>(<it>Sugar baby</it>). Results were date <it>F </it>= 121.648, <it>p </it>&#8804; 0.001; treatment <it>F </it>= 24.728, <it>p </it>&#8804; 0.001; date &#215; treatment <it>F </it>= 2.283, <it>p </it>= 0.077. Dataset 6 was the five independent assays of Oregon-R crossed to <it>rtTA(3)E2 </it>(Table <tblr tid="T2">2</tblr>). Results were date <it>F </it>= 28.171, <it>p </it>&lt; 0.001, treatment <it>F </it>= 0.005, <it>p </it>= 0.944, date &#215; treatment <it>F </it>= 2.313, <it>p </it>= 0.056. Dataset 7 was the two independent assays of line <it>PdL(3)8S64 </it>(<it>filamin</it>). Results were date <it>F </it>= 7.192, <it>p </it>= 0.007, treatment <it>F </it>= 17.871, <it>p </it>&lt; 0.001, date &#215; treatment <it>F </it>= 0.057, <it>p </it>= 0.812. Dataset 8 was the two independent assays of line <it>PdL(3)8S25 </it>(<it>fwd</it>). Results were date <it>F </it>= 5.319, <it>p </it>= 0.021, treatment <it>F </it>= 23.784, <it>p </it>&lt; 0.001, date &#215; treatment <it>F </it>= 0.271, <it>p </it>= 0.603. Dataset 9 was the two independent assays of line <it>PdL(3)8R128 </it>(<it>Cct1</it>). Results were date <it>F </it>= 15.405, <it>p </it>&lt; 0.001, treatment <it>F </it>= 17.177, <it>p </it>&lt; 0.001, date &#215; treatment <it>F </it>= 0.455, <it>p </it>= 0.500. Dataset 10 was the three independent assays of Oregon-R crossed to <it>rtTA(3)M1</it>. Results were date <it>F </it>= 16.611, <it>p </it>&lt; 0.001, treatment <it>F </it>= 3.777, <it>p </it>= 0.052, date &#215; treatment <it>F </it>= 0.315, <it>p </it>= 0.730.</p>
         <sec>
            <st>
               <p>Southern analysis of <it>PdL </it>copy number</p>
            </st>
            <p>DNA was isolated from <it>PdL </it>lines and restriction digested with <it>Xba</it>I, <it>Hind</it>III, <it>Pst</it>I and <it>Taq</it>I in separate reactions. DNA was transferred to a Southern blot and hybridized with a radiolabeled 172 bp fragment from the 3' P end of <it>PdL</it>. This probe fragment was generated by PCR amplification with primers located within the 3' P end, IRREV (ATGATGAAATAACATAAGGTGGTCCCG) and P3MCSREV (ATGAGTTAATTCAAACCCCACGGACAT).</p>
         </sec>
         <sec>
            <st>
               <p>Inverse PCR amplification of <it>PdL </it>flanking sequences</p>
            </st>
            <p>Protocols were as previously described [<abbr bid="B60">60</abbr>,<abbr bid="B61">61</abbr>]. Briefly, DNA equivalent to one fly was restriction digested with <it>Taq</it>I. The DNA was extracted with phenol/chloroform, precipitated with ethanol, resuspended and treated with T4 ligase overnight at 16&#176;C. PCR amplification was performed using primers Pry1 (CCTTAGCATGTCCGTGGGGTTTGAAT) and IR (CGGGACCACCTTATGTTATTTCATCATG) located in the 3' P end. PCR protocol was as follows: step 1, 95&#176;C for 5 min; step 2, 95&#176;C for 30 sec; step 3, 51&#176;C for 1 min; step 4, 72&#176;C for 1 min; step 5, repeat steps 2-4 40 times; step 6, 72&#176;C for 10 min. The PCR product was subcloned into the pCR2.1-TOPO cloning vector (Invitrogen). Dideoxy sequencing was carried out using the Sequenase version 2.0 DNA sequencing kit (US Biochemical) and the T7 and M13 reverse sequencing primers. Each inverse PCR product will contain 284 bp of 3' P-element sequences. The sizes of the products were: <it>PdL(3)3E36 </it>(<it>Red herring/encore</it>) 534 bp; <it>PdL(2)4G14 </it>(<it>VhaSFD</it>) 465 bp; <it>PdL(3)2C33 </it>(<it>Sugar baby</it>) 464 bp; <it>PdL(3)8S64 </it>(<it>filamin</it>) 362 bp; <it>PdL(3)8S25 </it>(<it>fwd</it>) 345 bp; <it>PdL(3)8R128 </it>(<it>Cct1</it>) 298 bp.</p>
         </sec>
         <sec>
            <st>
               <p>DNA sequence analyses</p>
            </st>
            <p><it>PdL</it>-flanldng DNA sequences were used to query GenBank databases using BLASTN with default settings as provided at the National Center for Biotechnology Information (NCBI) website [<abbr bid="B62">62</abbr>]. Genomic scaffold sequences and numbering and ORF designations are according to the NCBI databases and <it>Drosophila </it>genome sequence [<abbr bid="B63">63</abbr>].</p>
         </sec>
         <sec>
            <st>
               <p>Northern blot analyses</p>
            </st>
            <p>RNA was isolated from adult <it>Drosophila </it>using the RNAqueous kit (Ambion), fractionated on 1.0% agarose gels and transferred to GeneScreen membranes (DuPont/NEN). 1x = 4 &#956;g, and 2x = 8 &#956;g, except for the analysis of <it>Sugar baby </it>where 1x = 8 &#956;g. The DNA probe for exon 5 of the <it>fwd </it>gene was generated by PCR amplification from <it>Drosophila </it>genomic DNA using primers FWDFWD (TGCTTCCTCCATTTGGCGAAC) and FWDREV (ATCATCTGTGGCTCAGAGTCG). The probe for exon 2 of the <it>VhaSFD </it>gene was generated using primers VhaFWD (CCAGCTGATCCTTCAGGAACTGC) and VhaREV (ACCAGGACGATCAACTGGGCTTC). The probe for exon 15 of the <it>filamin </it>A gene was generated using primers AMINAFWD (GCCAATGTAGGCCTTCTTCAG) and FILAMINAREV (ATCCATGCCATCCACGTCAAG). The probe for exon 1 of the <it>CG1049 </it>gene was generated using primers CG1049EX1FWD (AGTTGTGTTTGTGTCCGACG) and CG1049EX1REV (ATAAACAGAGCAGAGCAGAGC). The probe for exon 4 of the <it>CG1049 </it>gene was generated using primers CG1049EX4FWD (TCTGTCCGATGAATTCATCGCC) and CG1049EX4REV (ATGATTCAGGTTCTCACGTCCG). The <it>CG14975 </it>ORF probe was generated using primers CG14975FWD (TCAGCCGAGAGATTCTAGAGAG) and CG14975REV (CATCGACCATTGTTCTCTCTCC). The 3E36 intergenic region probe was generated using primers 3E36-140120FWD (TTTCCATTTCCCTTCCACTGCC) and 3E36-1406038REV (TTACAGCTGCTCACTCACTCAC). The probe for exon 3 of the <it>encore </it>gene was generated using primers ENCFWD (AATGAAGCGGAGTTCCCAAAGC) and ENCREV (ATAAAGCCCGAGGTGTTGTTGC). The probe for exon 3 of the <it>Hr39 </it>gene was generated using primers Hr39FWD (ACATGTCCAGCATCAAAGCGG) and Hr39REV (TATCGGTTGTAGTGCGCAGAC). The 8R96 intergenic region probe was generated using primers 8R96-225683FWD (CAAGTGGGCTCCATAATAGC) and 8R96-226069REV (TGGAGCTCTCGGTCTGTTAG). The probe for exon 4 of the <it>CG8677 </it>gene was generated using primers CG8677FWD (ATCCGTACCAGTGGCTAAAAGG) and CG8677REV (TTCTTCAACAGCACCACTCGTC). The loading control was ribosomal protein gene <it>Rp49 </it>[<abbr bid="B64">64</abbr>]. DNA probes were <sup>32</sup>P-labeled using the Prime-It II DNA labeling kit (Stratagene). Hybridization was carried out in Church-Gilbert solution at 65&#176;C overnight. Hybridization signals were visualized and quantitated using the phosphoimager and ImageQuant software (Molecular Dynamics), and exposure times were 4 days. Transcript size was determined by comparison with 1 kb RNA ladder (Gibco-BRL) according to the manufacturer's instructions.</p>
            <p>Relative RNA levels and the fold induction of transcripts in the presence of DOX were estimated as follows. A box was drawn around the band for each gene transcript and intensity measured in arbitrary units using the phosphoimager and ImageQuant. An equal sized box was drawn around a region of the lane containing no bands and that value was subtracted as background. <it>Rp49 </it>loading control was quantitated in the same way for each lane. Each <it>Rp49 </it>intensity value was divided by the median <it>Rp49 </it>intensity value to generate a loading correction factor for each lane. A normalized intensity value for each gene transcript was then calculated by multiplying by the <it>Rp49 </it>correction factor for that lane. This quantitation was done twice for each phosphoimage. The 1x and 2x northern lanes for each RNA sample were quantitated and the numbers were averaged. The resulting relative expression levels are presented in arbitrary units &#177; standard deviation (SD). <it>VhaSFD</it>: -DOX = 4.8 &#177; 1.2; +DOX = 20 &#177; 5.5; fold induction approximately 4. <it>Sugar baby</it>: -DOX = 1.5 &#177; 0.5; +DOX = 12.8 &#177; 2.4; fold induction approximately 8.5. <it>filamin</it>: -DOX = 59 &#177; 11; +DOX = 318 &#177; 64; fold induction approximately 5. <it>fwd</it>: -DOX = 240&#177; 7; +DOX = 2,303&#177; 28; fold induction approximately 10. <it>Cct</it>: -DOX = 2.3 &#177; 0.4; +DOX = 4.0 &#177; 0.2; fold induction approximately 1.7.</p>
         </sec>
      </sec>
      <sec>
         <st>
            <p>Additional data files</p>
         </st>
         <p>A <supplr sid="s1">table</supplr> showing the calculation of 95% confidence intervals for all the datasets is available.</p>
         <suppl id="s1">
            <title>
               <p>Additional data file 1</p>
            </title>
            <caption>
               <p>A table showing the calculation of 95% confidence intervals</p>
            </caption>
            <text>
               <p>A table showing the calculation of 95% confidence intervals.</p>
            </text>
            <file name="gb-2003-4-2-r8-s1.doc">
               <p>Click here for additional data file</p>
            </file>
         </suppl>
      </sec>
   </bdy>
   <bm>
      <ack>
         <sec>
            <st>
               <p>Acknowledgements</p>
            </st>
            <p>We thank the following undergraduates and graduate rotation students for helping with the genetic screen: Yasmin Alt, Rapee Boomplueang, Briana Chavez, Shama Currimbhoy, Sherif Hanna, Mark Heller, Michael Hsu, Hnin Htun, Armine Karapetian, Jimmy Lee, John Lee, Paymann Moin, Viet Nguyen, Neil Rampal, Deepali Shinde, Vanessa Yu and Yvette Yeung. This research was supported by a grant from the Department of Health and Human Services to J.T. (AG11644). We thank Beth E. Rabin for expert assistance with statistical analyses.</p>
         </sec>
      </ack>
      <refgrp>
         <bibl id="B1">
            <title>
               <p>Review of genetic investigations into the aging process of <it>Drosophila</it>.</p>
            </title>
            <aug>
               <au>
                  <snm>Arking</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Dudas</snm>
                  <fnm>SP</fnm>
               </au>
            </aug>
            <source>J Am Geriatr Soc</source>
            <pubdate>1989</pubdate>
            <volume>37</volume>
            <fpage>757</fpage>
            <lpage>773</lpage>
            <xrefbib>
               <pubid idtype="pmpid">2502570</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B2">
            <title>
               <p>Aging in <it>Drosophila</it>.</p>
            </title>
            <aug>
               <au>
                  <snm>Baker</snm>
                  <fnm>GT</fnm>
               </au>
               <au>
                  <snm>Jacobsen</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Mokrynski</snm>
                  <fnm>G</fnm>
               </au>
            </aug>
            <source>In Cell Biology Handbook in Aging</source>
            <publisher>Boca Raton, FL: CRC Press</publisher>
            <editor>Cristofalo V</editor>
            <pubdate>1989</pubdate>
            <fpage>511</fpage>
            <lpage>578</lpage>
         </bibl>
         <bibl id="B3">
            <aug>
               <au>
                  <snm>Rose</snm>
                  <fnm>MR</fnm>
               </au>
            </aug>
            <source>Evolutionary Biology of Aging</source>
            <publisher>New York: Oxford University Press</publisher>
            <pubdate>1991</pubdate>
         </bibl>
         <bibl id="B4">
            <title>
               <p>Aging mechanisms in fruit flies.</p>
            </title>
            <aug>
               <au>
                  <snm>Tower</snm>
                  <fnm>J</fnm>
               </au>
            </aug>
            <source>BioEssays</source>
            <pubdate>1996</pubdate>
            <volume>18</volume>
            <fpage>799</fpage>
            <lpage>807</lpage>
            <xrefbib>
               <pubid idtype="pmpid">8885717</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B5">
            <title>
               <p>Transgenic methods for increasing <it>Drosophila </it>life span.</p>
            </title>
            <aug>
               <au>
                  <snm>Tower</snm>
                  <fnm>J</fnm>
               </au>
            </aug>
            <source>Mech Ageing Dev</source>
            <pubdate>2000</pubdate>
            <volume>118</volume>
            <fpage>1</fpage>
            <lpage>14</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/S0047-6374(00)00152-4</pubid>
                  <pubid idtype="pmpid" link="fulltext">10989120</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B6">
            <title>
               <p>Selection for delayed senescence in <it>Drosophila melanogaster.</it></p>
            </title>
            <aug>
               <au>
                  <snm>Luckinbill</snm>
                  <fnm>LS</fnm>
               </au>
               <au>
                  <snm>Arking</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Clare</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Cirocco</snm>
                  <fnm>W</fnm>
               </au>
               <au>
                  <snm>Buck</snm>
                  <fnm>S</fnm>
               </au>
            </aug>
            <source>Evolution</source>
            <pubdate>1984</pubdate>
            <volume>38</volume>
            <fpage>996</fpage>
            <lpage>1003</lpage>
         </bibl>
         <bibl id="B7">
            <title>
               <p>Direct and correlated responses to selection on age at reproduction in <it>Drosophila melanogaster.</it></p>
            </title>
            <aug>
               <au>
                  <snm>Partridge</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Fowler</snm>
                  <fnm>K</fnm>
               </au>
            </aug>
            <source>Evolution</source>
            <pubdate>1992</pubdate>
            <volume>46</volume>
            <fpage>76</fpage>
            <lpage>91</lpage>
         </bibl>
         <bibl id="B8">
            <title>
               <p>A test of evolutionary theories of senescence.</p>
            </title>
            <aug>
               <au>
                  <snm>Rose</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Charlesworth</snm>
                  <fnm>B</fnm>
               </au>
            </aug>
            <source>Nature</source>
            <pubdate>1980</pubdate>
            <volume>287</volume>
            <fpage>141</fpage>
            <lpage>142</lpage>
            <xrefbib>
               <pubid idtype="pmpid">6776406</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B9">
            <title>
               <p>Elevated paraquat resistance can be used as a bioassay for longevity in a genetically based long-lived strain of <it>Drosophila.</it></p>
            </title>
            <aug>
               <au>
                  <snm>Arking</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Buck</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Berrios</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Dwyer</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Baker</snm>
                  <fnm>GT</fnm>
               </au>
            </aug>
            <source>Dev Genet</source>
            <pubdate>1991</pubdate>
            <volume>12</volume>
            <fpage>362</fpage>
            <lpage>370</lpage>
            <xrefbib>
               <pubid idtype="pmpid">1806332</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B10">
            <title>
               <p>Resistance to environmental stress in <it>Drosophila melanogaster </it>selected for postponed senescence.</p>
            </title>
            <aug>
               <au>
                  <snm>Service</snm>
                  <fnm>PM</fnm>
               </au>
               <au>
                  <snm>Hutchinson</snm>
                  <fnm>MD</fnm>
               </au>
               <au>
                  <snm>MacKinley</snm>
                  <fnm>MD</fnm>
               </au>
               <au>
                  <snm>Rose</snm>
                  <fnm>MR</fnm>
               </au>
            </aug>
            <source>Physiol Zool</source>
            <pubdate>1985</pubdate>
            <volume>58</volume>
            <fpage>380</fpage>
            <lpage>389</lpage>
         </bibl>
         <bibl id="B11">
            <title>
               <p>Effects of temperature on the life span, vitality and fine structure of <it>Drosophila melanogaster</it>.</p>
            </title>
            <aug>
               <au>
                  <snm>Miquel</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Lundgren</snm>
                  <fnm>PR</fnm>
               </au>
               <au>
                  <snm>Bensch</snm>
                  <fnm>KG</fnm>
               </au>
               <au>
                  <snm>Atlan</snm>
                  <fnm>H</fnm>
               </au>
            </aug>
            <source>Mech Ageing Dev</source>
            <pubdate>1976</pubdate>
            <volume>5</volume>
            <fpage>347</fpage>
            <lpage>370</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/0047-6374(76)90034-8</pubid>
                  <pubid idtype="pmpid">823384</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B12">
            <title>
               <p>Metabolic rates in genetically based long lived strains of <it>Drosophila</it>.</p>
            </title>
            <aug>
               <au>
                  <snm>Arking</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Buck</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Wells</snm>
                  <fnm>RA</fnm>
               </au>
               <au>
                  <snm>Pretzlaff</snm>
                  <fnm>R</fnm>
               </au>
            </aug>
            <source>Exp Gerontol</source>
            <pubdate>1988</pubdate>
            <volume>23</volume>
            <fpage>59</fpage>
            <lpage>76</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/0531-5565(88)90020-4</pubid>
                  <pubid idtype="pmpid">3384030</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B13">
            <title>
               <p>Age-specific decrease in aerobic efficiency associated with increase in oxygen free radical production in <it>Drosophila melanogaster</it>.</p>
            </title>
            <aug>
               <au>
                  <snm>Ross</snm>
                  <fnm>RE</fnm>
               </au>
            </aug>
            <source>J Insect Physiol</source>
            <pubdate>2000</pubdate>
            <volume>46</volume>
            <fpage>1477</fpage>
            <lpage>1480</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/S0022-1910(00)00072-X</pubid>
                  <pubid idtype="pmpid" link="fulltext">10891576</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B14">
            <title>
               <p>Extended life-span and stress resistance in the <it>Drosophila </it>mutant <it>methuselah</it>.</p>
            </title>
            <aug>
               <au>
                  <snm>Lin</snm>
                  <fnm>Y-J</fnm>
               </au>
               <au>
                  <snm>Seroude</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Benzer</snm>
                  <fnm>S</fnm>
               </au>
            </aug>
            <source>Science</source>
            <pubdate>1998</pubdate>
            <volume>282</volume>
            <fpage>943</fpage>
            <lpage>946</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1126/science.282.5390.943</pubid>
                  <pubid idtype="pmpid" link="fulltext">9794765</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B15">
            <title>
               <p>Extended life-span conferred by cotransporter gene mutations in <it>Drosophila</it>.</p>
            </title>
            <aug>
               <au>
                  <snm>Rogina</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Reenan</snm>
                  <fnm>RA</fnm>
               </au>
               <au>
                  <snm>Nilsen</snm>
                  <fnm>SP</fnm>
               </au>
               <au>
                  <snm>Helfand</snm>
                  <fnm>S</fnm>
               </au>
            </aug>
            <source>Science</source>
            <pubdate>2000</pubdate>
            <volume>290</volume>
            <fpage>2137</fpage>
            <lpage>2140</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1126/science.290.5499.2137</pubid>
                  <pubid idtype="pmpid" link="fulltext">11118146</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B16">
            <title>
               <p>Extension of life-span by loss of CHICO, a <it>Drosophila </it>insulin receptor substrate protein.</p>
            </title>
            <aug>
               <au>
                  <snm>Clancy</snm>
                  <fnm>DJ</fnm>
               </au>
               <au>
                  <snm>Gems</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Harshman</snm>
                  <fnm>LG</fnm>
               </au>
               <au>
                  <snm>Oldham</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Stocker</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Hafen</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Leevers</snm>
                  <fnm>SJ</fnm>
               </au>
               <au>
                  <snm>Partridge</snm>
                  <fnm>L</fnm>
               </au>
            </aug>
            <source>Science</source>
            <pubdate>2001</pubdate>
            <volume>292</volume>
            <fpage>104</fpage>
            <lpage>106</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1126/science.1057991</pubid>
                  <pubid idtype="pmpid" link="fulltext">11292874</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B17">
            <title>
               <p>A mutant <it>Drosophila </it>insulin receptor homolog that extends life-span and impairs neuroendocrine function.</p>
            </title>
            <aug>
               <au>
                  <snm>Tatar</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Kopelman</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Epstein</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Tu</snm>
                  <fnm>M-P</fnm>
               </au>
               <au>
                  <snm>Yin</snm>
                  <fnm>C-M</fnm>
               </au>
               <au>
                  <snm>Garofalo</snm>
                  <fnm>RS</fnm>
               </au>
            </aug>
            <source>Science</source>
            <pubdate>2001</pubdate>
            <volume>292</volume>
            <fpage>107</fpage>
            <lpage>110</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1126/science.1057987</pubid>
                  <pubid idtype="pmpid" link="fulltext">11292875</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B18">
            <title>
               <p>A conserved regulatory system for aging.</p>
            </title>
            <aug>
               <au>
                  <snm>Kenyon</snm>
                  <fnm>C</fnm>
               </au>
            </aug>
            <source>Cell</source>
            <pubdate>2001</pubdate>
            <volume>105</volume>
            <fpage>165</fpage>
            <lpage>168</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/S0092-8674(01)00306-3</pubid>
                  <pubid idtype="pmpid" link="fulltext">11336665</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B19">
            <title>
               <p>Aging and resistance to oxidative stress in <it>Caenorhabditis elegans</it>.</p>
            </title>
            <aug>
               <au>
                  <snm>Larsen</snm>
                  <fnm>PL</fnm>
               </au>
            </aug>
            <source>Proc Natl Acad Sci USA</source>
            <pubdate>1993</pubdate>
            <volume>90</volume>
            <fpage>8905</fpage>
            <lpage>8909</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">47469</pubid>
                  <pubid idtype="pmpid" link="fulltext">8415630</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B20">
            <title>
               <p>Thermotolerance and extended life span conferred by single-gene mutations and induced by thermal stress.</p>
            </title>
            <aug>
               <au>
                  <snm>Lithgow</snm>
                  <fnm>GJ</fnm>
               </au>
               <au>
                  <snm>White</snm>
                  <fnm>TM</fnm>
               </au>
               <au>
                  <snm>Melov</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Johnson</snm>
                  <fnm>TE</fnm>
               </au>
            </aug>
            <source>Proc Natl Acad Sci USA</source>
            <pubdate>1995</pubdate>
            <volume>92</volume>
            <fpage>7540</fpage>
            <lpage>7544</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">41375</pubid>
                  <pubid idtype="pmpid" link="fulltext">7638227</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B21">
            <title>
               <p>Life extension and stress resistance in <it>Caenorhabditis elegans </it>modulated by the <it>tkr-1 </it>gene.</p>
            </title>
            <aug>
               <au>
                  <snm>Murakami</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Johnson</snm>
                  <fnm>TE</fnm>
               </au>
            </aug>
            <source>Curr Biol</source>
            <pubdate>1998</pubdate>
            <volume>8</volume>
            <fpage>1091</fpage>
            <lpage>1094</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">9768365</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B22">
            <title>
               <p>The <it>daf-2 </it>gene network for longevity regulates oxidative stress resistance and <it>Mn-superoxide dismutase </it>gene expression in <it>Caenorhabditis elegans</it>.</p>
            </title>
            <aug>
               <au>
                  <snm>Honda</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Honda</snm>
                  <fnm>S</fnm>
               </au>
            </aug>
            <source>FASEB J</source>
            <pubdate>1999</pubdate>
            <volume>13</volume>
            <fpage>1385</fpage>
            <lpage>1393</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">10428762</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B23">
            <title>
               <p>Extension of <it>Drosophila </it>lifespan by overexpression of human <it>SOD1 </it>in motorneurons.</p>
            </title>
            <aug>
               <au>
                  <snm>Parkes</snm>
                  <fnm>TL</fnm>
               </au>
               <au>
                  <snm>Elia</snm>
                  <fnm>AJ</fnm>
               </au>
               <au>
                  <snm>Dickson</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Hilliker</snm>
                  <fnm>AJ</fnm>
               </au>
               <au>
                  <snm>Phillips</snm>
                  <fnm>JP</fnm>
               </au>
               <au>
                  <snm>Boulianne</snm>
                  <fnm>GL</fnm>
               </au>
            </aug>
            <source>Nature Genet</source>
            <pubdate>1998</pubdate>
            <volume>19</volume>
            <fpage>171</fpage>
            <lpage>174</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1038/534</pubid>
                  <pubid idtype="pmpid" link="fulltext">9620775</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B24">
            <title>
               <p>Induced overexpression of mitochondrial Mn-superoxide dismutase extends the life span of adult <it>Drosophila melanogaster</it>.</p>
            </title>
            <aug>
               <au>
                  <snm>Sun</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Folk</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Bradley</snm>
                  <fnm>TJ</fnm>
               </au>
               <au>
                  <snm>Tower</snm>
                  <fnm>J</fnm>
               </au>
            </aug>
            <source>Genetics</source>
            <pubdate>2002</pubdate>
            <volume>161</volume>
            <fpage>661</fpage>
            <lpage>672</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">12072463</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B25">
            <title>
               <p>FLP recombinase-mediated induction of Cu/Zn-superoxide dismutase transgene expression can extend the life span of adult <it>Drosophila melanogaster </it>flies.</p>
            </title>
            <aug>
               <au>
                  <snm>Sun</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Tower</snm>
                  <fnm>J</fnm>
               </au>
            </aug>
            <source>Mol Cell Biol</source>
            <pubdate>1999</pubdate>
            <volume>19</volume>
            <fpage>216</fpage>
            <lpage>228</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">83880</pubid>
                  <pubid idtype="pmpid" link="fulltext">9858546</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B26">
            <title>
               <p>High-quality life extension by the enzyme peptide methionine sulfoxide reductase.</p>
            </title>
            <aug>
               <au>
                  <snm>Ruan</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Tang</snm>
                  <fnm>XD</fnm>
               </au>
               <au>
                  <snm>Chen</snm>
                  <fnm>M-L</fnm>
               </au>
               <au>
                  <snm>Joiner</snm>
                  <fnm>MA</fnm>
               </au>
               <au>
                  <snm>Sun</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Brot</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Wiessbach</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Heinemann</snm>
                  <fnm>SH</fnm>
               </au>
               <au>
                  <snm>Iverson</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Wu</snm>
                  <fnm>C-F</fnm>
               </au>
               <au>
                  <snm>Hoshi</snm>
                  <fnm>T</fnm>
               </au>
            </aug>
            <source>Proc Natl Acad Sci USA</source>
            <pubdate>2002</pubdate>
            <volume>99</volume>
            <fpage>2748</fpage>
            <lpage>2753</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">122419</pubid>
                  <pubid idtype="pmpid" link="fulltext">11867705</pubid>
                  <pubid idtype="doi">10.1073/pnas.032671199</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B27">
            <title>
               <p>Extension of the <it>Drosophila </it>life span by overexpression of a protein repair methyltransferase.</p>
            </title>
            <aug>
               <au>
                  <snm>Chavous</snm>
                  <fnm>DA</fnm>
               </au>
               <au>
                  <snm>Jackson</snm>
                  <fnm>FR</fnm>
               </au>
               <au>
                  <snm>O'Connor</snm>
                  <fnm>CM</fnm>
               </au>
            </aug>
            <source>Proc Natl Acad Sci USA</source>
            <pubdate>2001</pubdate>
            <volume>98</volume>
            <fpage>14814</fpage>
            <lpage>14818</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">64941</pubid>
                  <pubid idtype="pmpid" link="fulltext">11742076</pubid>
                  <pubid idtype="doi">10.1073/pnas.251446498</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B28">
            <title>
               <p>Neural-specific over-expression of <it>Drosophila Plenty of SH3s </it>(<it>DPOSH</it>) extends the longevity of adult flies.</p>
            </title>
            <aug>
               <au>
                  <snm>Seong</snm>
                  <fnm>K-H</fnm>
               </au>
               <au>
                  <snm>Matsuo</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Fuyama</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Aigaki</snm>
                  <fnm>T</fnm>
               </au>
            </aug>
            <source>Biogerontology</source>
            <pubdate>2001</pubdate>
            <volume>2</volume>
            <fpage>271</fpage>
            <lpage>281</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1023/A:1013249326285</pubid>
                  <pubid idtype="pmpid" link="fulltext">11868902</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B29">
            <title>
               <p>Application of the gene search system to screen for longevity genes in <it>Drosophila</it>.</p>
            </title>
            <aug>
               <au>
                  <snm>Seong</snm>
                  <fnm>K-H</fnm>
               </au>
               <au>
                  <snm>Ogashiwa</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Matsuo</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Fuyama</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Aigaki</snm>
                  <fnm>T</fnm>
               </au>
            </aug>
            <source>Biogerontology</source>
            <pubdate>2001</pubdate>
            <volume>2</volume>
            <fpage>209</fpage>
            <lpage>217</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1023/A:1011517325711</pubid>
                  <pubid idtype="pmpid" link="fulltext">11708722</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B30">
            <title>
               <p>Chaperoning extended life.</p>
            </title>
            <aug>
               <au>
                  <snm>Tatar</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Khazaeli</snm>
                  <fnm>AA</fnm>
               </au>
               <au>
                  <snm>Curtsinger</snm>
                  <fnm>JW</fnm>
               </au>
            </aug>
            <source>Nature</source>
            <pubdate>1997</pubdate>
            <volume>390</volume>
            <fpage>30</fpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1038/36237</pubid>
                  <pubid idtype="pmpid" link="fulltext">9363888</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B31">
            <title>
               <p>P element insertion-dependent gene activation in the <it>Drosophila </it>eye.</p>
            </title>
            <aug>
               <au>
                  <snm>Hay</snm>
                  <fnm>BA</fnm>
               </au>
               <au>
                  <snm>Maile</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Rubin</snm>
                  <fnm>GM</fnm>
               </au>
            </aug>
            <source>Proc Natl Acad Sci USA</source>
            <pubdate>1997</pubdate>
            <volume>94</volume>
            <fpage>5195</fpage>
            <lpage>5200</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">24655</pubid>
                  <pubid idtype="pmpid" link="fulltext">9144214</pubid>
                  <pubid idtype="doi">10.1073/pnas.94.10.5195</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B32">
            <title>
               <p>A modular misexpression screen in <it>Drosophila </it>detecting tissue-specific phenotypes.</p>
            </title>
            <aug>
               <au>
                  <snm>Rorth</snm>
                  <fnm>P</fnm>
               </au>
            </aug>
            <source>Proc Natl Acad Sci USA</source>
            <pubdate>1996</pubdate>
            <volume>93</volume>
            <fpage>12418</fpage>
            <lpage>12422</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">38006</pubid>
                  <pubid idtype="pmpid" link="fulltext">8901596</pubid>
                  <pubid idtype="doi">10.1073/pnas.93.22.12418</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B33">
            <title>
               <p>Doxycycline-induced transgene expression during <it>Drosophila </it>development and aging.</p>
            </title>
            <aug>
               <au>
                  <snm>Bieschke</snm>
                  <fnm>ET</fnm>
               </au>
               <au>
                  <snm>Wheeler</snm>
                  <fnm>JC</fnm>
               </au>
               <au>
                  <snm>Tower</snm>
                  <fnm>J</fnm>
               </au>
            </aug>
            <source>Mol Gen Genet</source>
            <pubdate>1998</pubdate>
            <volume>258</volume>
            <fpage>571</fpage>
            <lpage>579</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1007/s004380050770</pubid>
                  <pubid idtype="pmpid">9671025</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B34">
            <title>
               <p>High-frequency generation of conditional mutations affecting <it>Drosophila </it>development and life span.</p>
            </title>
            <aug>
               <au>
                  <snm>Landis</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Bhole</snm>
                  <fnm/>
               </au>
               <au>
                  <snm>Lu</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Tower</snm>
                  <fnm>J</fnm>
               </au>
            </aug>
            <source>Genetics</source>
            <pubdate>2001</pubdate>
            <volume>158</volume>
            <fpage>1167</fpage>
            <lpage>1176</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">11454765</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B35">
            <title>
               <p>Encore is a member of a novel family of proteins and affects multiple processes in <it>Drosophila </it>oogenesis.</p>
            </title>
            <aug>
               <au>
                  <snm>Buskirk</snm>
                  <fnm>CV</fnm>
               </au>
               <au>
                  <snm>Hawkins</snm>
                  <fnm>NC</fnm>
               </au>
               <au>
                  <snm>Schupbach</snm>
                  <fnm>T</fnm>
               </au>
            </aug>
            <source>Development</source>
            <pubdate>2000</pubdate>
            <volume>127</volume>
            <fpage>4753</fpage>
            <lpage>4762</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">11044391</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B36">
            <title>
               <p>The multifunctional <it>Drosophila melanogaster </it>V-ATPase is encoded by a multigene family.</p>
            </title>
            <aug>
               <au>
                  <snm>Dow</snm>
                  <fnm>JAT</fnm>
               </au>
            </aug>
            <source>J Bioenerg Biomembr</source>
            <pubdate>1999</pubdate>
            <volume>31</volume>
            <fpage>75</fpage>
            <lpage>83</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1023/A:1005400731289</pubid>
                  <pubid idtype="pmpid">10340851</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B37">
            <title>
               <p>Molecular cloning of a maltose transport gene from <it>Bacillus stearothermophilus </it>and its expression in <it>Escherichia coli </it>K-12.</p>
            </title>
            <aug>
               <au>
                  <snm>Liong</snm>
                  <fnm>EC</fnm>
               </au>
               <au>
                  <snm>Ferenci</snm>
                  <fnm>T</fnm>
               </au>
            </aug>
            <source>Mol Gen Genet</source>
            <pubdate>1994</pubdate>
            <volume>243</volume>
            <fpage>343</fpage>
            <lpage>352</lpage>
            <xrefbib>
               <pubid idtype="pmpid">8190087</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B38">
            <title>
               <p>Filamin is required for ring canal assembly and actin organization during <it>Drosophila </it>oogenesis.</p>
            </title>
            <aug>
               <au>
                  <snm>Li</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Serr</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Edwards</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Ludmann</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Yamamoto</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Tilney</snm>
                  <fnm>LG</fnm>
               </au>
               <au>
                  <snm>Field</snm>
                  <fnm>CM</fnm>
               </au>
               <au>
                  <snm>Hays</snm>
                  <fnm>TS</fnm>
               </au>
            </aug>
            <source>J Cell Biol</source>
            <pubdate>1999</pubdate>
            <volume>146</volume>
            <fpage>1061</fpage>
            <lpage>1073</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1083/jcb.146.5.1061</pubid>
                  <pubid idtype="pmpid" link="fulltext">10477759</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B39">
            <title>
               <p><it>Drosophila </it>Filamin encoded by the <it>cheerio </it>locus is a component of ovarian ring canals.</p>
            </title>
            <aug>
               <au>
                  <snm>Sokol</snm>
                  <fnm>NS</fnm>
               </au>
               <au>
                  <snm>Cooley</snm>
                  <fnm>L</fnm>
               </au>
            </aug>
            <source>Curr Biol</source>
            <pubdate>1999</pubdate>
            <volume>9</volume>
            <fpage>1221</fpage>
            <lpage>1230</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/S0960-9822(99)80502-8</pubid>
                  <pubid idtype="pmpid" link="fulltext">10556087</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B40">
            <title>
               <p>A phospholipid kinase regulates actin organization and intercellular bridge formation during germline cytokinesis.</p>
            </title>
            <aug>
               <au>
                  <snm>Brill</snm>
                  <fnm>JA</fnm>
               </au>
               <au>
                  <snm>Hime</snm>
                  <fnm>GR</fnm>
               </au>
               <au>
                  <snm>Scharer-Schuksz</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Fuller</snm>
                  <fnm>MT</fnm>
               </au>
            </aug>
            <source>Development</source>
            <pubdate>2000</pubdate>
            <volume>127</volume>
            <fpage>3855</fpage>
            <lpage>3864</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">10934029</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B41">
            <title>
               <p>Regulation of CTP:phosphocholine cytidylyltransferase by amphitropism and relocalization.</p>
            </title>
            <aug>
               <au>
                  <snm>Cornell</snm>
                  <fnm>RB</fnm>
               </au>
               <au>
                  <snm>Northwood</snm>
                  <fnm>IC</fnm>
               </au>
            </aug>
            <source>Trends Biochem Sci</source>
            <pubdate>2000</pubdate>
            <volume>25</volume>
            <fpage>441</fpage>
            <lpage>447</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/S0968-0004(00)01625-X</pubid>
                  <pubid idtype="pmpid" link="fulltext">10973058</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B42">
            <title>
               <p>A <it>C. elegans </it>mutant that lives twice as long as wild type.</p>
            </title>
            <aug>
               <au>
                  <snm>Kenyon</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Chang</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Gensch</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Rudner</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Tabtiang</snm>
                  <fnm>R</fnm>
               </au>
            </aug>
            <source>Nature</source>
            <pubdate>1993</pubdate>
            <volume>366</volume>
            <fpage>461</fpage>
            <lpage>464</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1038/366461a0</pubid>
                  <pubid idtype="pmpid" link="fulltext">8247153</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B43">
            <title>
               <p>Genes that regulate both development and longevity in <it>Caenorhabditis elegans.</it></p>
            </title>
            <aug>
               <au>
                  <snm>Larsen</snm>
                  <fnm>PL</fnm>
               </au>
               <au>
                  <snm>Albert</snm>
                  <fnm>PS</fnm>
               </au>
               <au>
                  <snm>Riddle</snm>
                  <fnm>DL</fnm>
               </au>
            </aug>
            <source>Genetics</source>
            <pubdate>1995</pubdate>
            <volume>139</volume>
            <fpage>1567</fpage>
            <lpage>1583</lpage>
            <xrefbib>
               <pubid idtype="pmpid">7789761</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B44">
            <title>
               <p>Encore is a member of a novel family of proteins and affects multiple processes in <it>Drosophila </it>oogenesis.</p>
            </title>
            <aug>
               <au>
                  <snm>Van Buskirk</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Hawkins</snm>
                  <fnm>NC</fnm>
               </au>
               <au>
                  <snm>Schupbach</snm>
                  <fnm>T</fnm>
               </au>
            </aug>
            <source>Development</source>
            <pubdate>2000</pubdate>
            <volume>127</volume>
            <fpage>4753</fpage>
            <lpage>4762</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">11044391</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B45">
            <title>
               <p>Structure and properties of the clathrin-coated vesicle and yeast vacuolar V-ATPases.</p>
            </title>
            <aug>
               <au>
                  <snm>Forgac</snm>
                  <fnm>M</fnm>
               </au>
            </aug>
            <source>J Bioenerg Biomembr</source>
            <pubdate>1999</pubdate>
            <volume>31</volume>
            <fpage>57</fpage>
            <lpage>65</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1023/A:1005496530380</pubid>
                  <pubid idtype="pmpid">10340849</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B46">
            <title>
               <p>Assembly of the yeast vacuolar proton-translocating ATPase.</p>
            </title>
            <aug>
               <au>
                  <snm>Graham</snm>
                  <fnm>LA</fnm>
               </au>
               <au>
                  <snm>Stevens</snm>
                  <fnm>TH</fnm>
               </au>
            </aug>
            <source>J Bioenerg Biomembr</source>
            <pubdate>1999</pubdate>
            <volume>31</volume>
            <fpage>39</fpage>
            <lpage>47</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1023/A:1005492429471</pubid>
                  <pubid idtype="pmpid">10340847</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B47">
            <title>
               <p>The vacuolar (H+)-ATPases - nature's most versatile proton pumps.</p>
            </title>
            <aug>
               <au>
                  <snm>Nishi</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Forgac</snm>
                  <fnm>M</fnm>
               </au>
            </aug>
            <source>Nat Rev Mol Cell Biol</source>
            <pubdate>2002</pubdate>
            <volume>3</volume>
            <fpage>94</fpage>
            <lpage>103</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1038/nrm729</pubid>
                  <pubid idtype="pmpid" link="fulltext">11836511</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B48">
            <title>
               <p>Amyloid, the presenilins and Alzheimer's disease.</p>
            </title>
            <aug>
               <au>
                  <snm>Hardy</snm>
                  <fnm>J</fnm>
               </au>
            </aug>
            <source>Trends Neurosci</source>
            <pubdate>1997</pubdate>
            <volume>20</volume>
            <fpage>154</fpage>
            <lpage>159</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/S0166-2236(96)01030-2</pubid>
                  <pubid idtype="pmpid" link="fulltext">9106355</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B49">
            <title>
               <p>Physical and genetic interaction of filamin with presenilin in <it>Drosophila</it>.</p>
            </title>
            <aug>
               <au>
                  <snm>Guo</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Zhang</snm>
                  <fnm>SJ</fnm>
               </au>
               <au>
                  <snm>Sokol</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Cooley</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Boulianne</snm>
                  <fnm>GL</fnm>
               </au>
            </aug>
            <source>J Cell Sci</source>
            <pubdate>2000</pubdate>
            <volume>113</volume>
            <fpage>3499</fpage>
            <lpage>3508</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">10984440</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B50">
            <title>
               <p>An activity-dependent network of interactions links the Rel protein Dorsal with its cytoplasmic regulators.</p>
            </title>
            <aug>
               <au>
                  <snm>Edwards</snm>
                  <fnm>DN</fnm>
               </au>
               <au>
                  <snm>Towb</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Wasserman</snm>
                  <fnm>SA</fnm>
               </au>
            </aug>
            <source>Development</source>
            <pubdate>1997</pubdate>
            <volume>124</volume>
            <fpage>3855</fpage>
            <lpage>3864</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">9367441</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B51">
            <title>
               <p>Phosphatidylinositol 4-kinases.</p>
            </title>
            <aug>
               <au>
                  <snm>Balla</snm>
                  <fnm>T</fnm>
               </au>
            </aug>
            <source>Biochim Biophys Acta</source>
            <pubdate>1998</pubdate>
            <volume>1436</volume>
            <fpage>69</fpage>
            <lpage>85</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/S0005-2760(98)00134-9</pubid>
                  <pubid idtype="pmpid">9838049</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B52">
            <title>
               <p>Phosphoinositide 4- and 5-kinases and the cellular roles of phosphatidylinositol 4,5-bis-phosphate.</p>
            </title>
            <aug>
               <au>
                  <snm>Hsuan</snm>
                  <fnm>JJ</fnm>
               </au>
               <au>
                  <snm>Minogue</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>dos Santos</snm>
                  <fnm>M</fnm>
               </au>
            </aug>
            <source>Adv Cancer Res</source>
            <pubdate>1998</pubdate>
            <volume>74</volume>
            <fpage>167</fpage>
            <lpage>216</lpage>
            <xrefbib>
               <pubid idtype="pmpid">9561269</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B53">
            <title>
               <p>Genetic pathways that regulate ageing in model organisms.</p>
            </title>
            <aug>
               <au>
                  <snm>Guarente</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Kenyon</snm>
                  <fnm>C</fnm>
               </au>
            </aug>
            <source>Nature</source>
            <pubdate>2000</pubdate>
            <volume>408</volume>
            <fpage>255</fpage>
            <lpage>262</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1038/35041700</pubid>
                  <pubid idtype="pmpid" link="fulltext">11089983</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B54">
            <title>
               <p>Regulation of life-span by germ-line stem cells in <it>Caenorhabditis elegans</it>.</p>
            </title>
            <aug>
               <au>
                  <snm>Arantes-Oliveira</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Apfeld</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Dillin</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Kenyon</snm>
                  <fnm>C</fnm>
               </au>
            </aug>
            <source>Science</source>
            <pubdate>2002</pubdate>
            <volume>295</volume>
            <fpage>502</fpage>
            <lpage>505</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1126/science.1065768</pubid>
                  <pubid idtype="pmpid" link="fulltext">11799246</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B55">
            <title>
               <p>Signals for the reproductive system regulate the lifespan of <it>C. elegans</it>.</p>
            </title>
            <aug>
               <au>
                  <snm>Hsin</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Kenyon</snm>
                  <fnm>C</fnm>
               </au>
            </aug>
            <source>Nature</source>
            <pubdate>1999</pubdate>
            <volume>399</volume>
            <fpage>362</fpage>
            <lpage>366</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1038/20694</pubid>
                  <pubid idtype="pmpid" link="fulltext">10360574</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B56">
            <title>
               <p>Regulation of the <it>Caenorhabditis elegans </it>longevity protein DAF-16 by insulin/IGF-1 and germline signalling.</p>
            </title>
            <aug>
               <au>
                  <snm>Lin</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Hsin</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Libina</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Kenyon</snm>
                  <fnm>C</fnm>
               </au>
            </aug>
            <source>Nature Genet</source>
            <pubdate>2001</pubdate>
            <volume>28</volume>
            <fpage>139</fpage>
            <lpage>145</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1038/88850</pubid>
                  <pubid idtype="pmpid" link="fulltext">11381260</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B57">
            <title>
               <p>Flybase</p>
            </title>
            <url>http://flybase.bio.indiana.edu</url>
         </bibl>
         <bibl id="B58">
            <aug>
               <au>
                  <snm>Lindsley</snm>
                  <fnm>DL</fnm>
               </au>
               <au>
                  <snm>Zimm</snm>
                  <fnm>GG</fnm>
               </au>
            </aug>
            <source>The Genome of Drosophila melanogaster</source>
            <publisher>San Diego, CA: Academic Press</publisher>
            <pubdate>1992</pubdate>
         </bibl>
         <bibl id="B59">
            <title>
               <p>Drosophila: A Laboratory Handbook.</p>
            </title>
            <aug>
               <au>
                  <snm>Ashburner</snm>
                  <fnm>M</fnm>
               </au>
            </aug>
            <source>Plainview, NY: Cold Spring Harbor Laboratory Press</source>
            <pubdate>1989</pubdate>
         </bibl>
         <bibl id="B60">
            <title>
               <p>Preferential transposition of <it>Drosophila </it>P elements to nearby chromosomal sites.</p>
            </title>
            <aug>
               <au>
                  <snm>Tower</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Karpen</snm>
                  <fnm>GH</fnm>
               </au>
               <au>
                  <snm>Craig</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Spradling</snm>
                  <fnm>AC</fnm>
               </au>
            </aug>
            <source>Genetics</source>
            <pubdate>1993</pubdate>
            <volume>113</volume>
            <fpage>347</fpage>
            <lpage>359</lpage>
            <xrefbib>
               <pubid idtype="pmpid">8382177</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B61">
            <title>
               <p>Preferential transposition of a <it>Drosophila </it>P element to the corresponding region of the homologous chromosome.</p>
            </title>
            <aug>
               <au>
                  <snm>Tower</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Kurapati</snm>
                  <fnm>R</fnm>
               </au>
            </aug>
            <source>Mol Gen Genet</source>
            <pubdate>1994</pubdate>
            <volume>244</volume>
            <fpage>484</fpage>
            <lpage>490</lpage>
            <xrefbib>
               <pubid idtype="pmpid">8078475</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B62">
            <title>
               <p>National Center for Biotechnology Information</p>
            </title>
            <url>http://www.ncbi.nlm.nih.gov</url>
         </bibl>
         <bibl id="B63">
            <title>
               <p>The genome sequence of <it>Drosophila melanogaster</it>.</p>
            </title>
            <aug>
               <au>
                  <snm>Adams</snm>
                  <fnm>MD</fnm>
               </au>
               <au>
                  <snm>Celniker</snm>
                  <fnm>SE</fnm>
               </au>
               <au>
                  <snm>Holt</snm>
                  <fnm>RA</fnm>
               </au>
               <au>
                  <snm>Evans</snm>
                  <fnm>CA</fnm>
               </au>
               <au>
                  <snm>Gocayne</snm>
                  <fnm>JD</fnm>
               </au>
               <au>
                  <snm>Amanatides</snm>
                  <fnm>PG</fnm>
               </au>
               <au>
                  <snm>Scherer</snm>
                  <fnm>SE</fnm>
               </au>
               <au>
                  <snm>Li</snm>
                  <fnm>PW</fnm>
               </au>
               <au>
                  <snm>Hoskins</snm>
                  <fnm>RA</fnm>
               </au>
               <au>
                  <snm>Galle</snm>
                  <fnm>RF</fnm>
               </au>
               <etal/>
            </aug>
            <source>Science</source>
            <pubdate>2000</pubdate>
            <volume>287</volume>
            <fpage>2185</fpage>
            <lpage>2195</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1126/science.287.5461.2185</pubid>
                  <pubid idtype="pmpid" link="fulltext">10731132</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B64">
            <title>
               <p>Sequence, structure, and codon preference of the <it>Drosophila </it>ribosomal protein 49 gene.</p>
            </title>
            <aug>
               <au>
                  <snm>O'Connell</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Rosbash</snm>
                  <fnm>M</fnm>
               </au>
            </aug>
            <source>Nucleic Acids Res</source>
            <pubdate>1984</pubdate>
            <volume>12</volume>
            <fpage>5495</fpage>
            <lpage>5513</lpage>
            <xrefbib>
               <pubid idtype="pmpid">6087289</pubid>
            </xrefbib>
         </bibl>
      </refgrp>
   </bm>
</art>

